Mutagenetix > Incidental Mutations

Incidental Mutation 'R6427:Nipbl'

518376

Institutional Source

Beutler Lab

Gene Symbol

Nipbl

Ensembl Gene

ENSMUSG00000022141

Gene Name

NIPBL cohesin loading factor

Synonyms

4921518A06Rik, 4933421G18Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.962) question?

Stock #

R6427 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

8290617-8444463 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 8351565 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Histidine at position 581 (L581H)

Ref Sequence

ENSEMBL: ENSMUSP00000059385 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000052965]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000052965
AA Change: L581H

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000059385
Gene: ENSMUSG00000022141
AA Change: L581H

Domain	Start	End	E-Value	Type
low complexity region	22	41	N/A	INTRINSIC
low complexity region	322	338	N/A	INTRINSIC
low complexity region	367	376	N/A	INTRINSIC
low complexity region	447	462	N/A	INTRINSIC
low complexity region	473	490	N/A	INTRINSIC
low complexity region	639	652	N/A	INTRINSIC
low complexity region	1020	1037	N/A	INTRINSIC
low complexity region	1081	1097	N/A	INTRINSIC
low complexity region	1102	1107	N/A	INTRINSIC
low complexity region	1114	1139	N/A	INTRINSIC
low complexity region	1165	1176	N/A	INTRINSIC
low complexity region	1389	1396	N/A	INTRINSIC
low complexity region	1577	1586	N/A	INTRINSIC
coiled coil region	1628	1656	N/A	INTRINSIC
Pfam:Cohesin_HEAT	1788	1829	1.1e-14	PFAM
Pfam:Nipped-B_C	2269	2450	2.8e-68	PFAM
low complexity region	2477	2501	N/A	INTRINSIC
low complexity region	2502	2512	N/A	INTRINSIC
low complexity region	2538	2550	N/A	INTRINSIC
low complexity region	2626	2632	N/A	INTRINSIC
low complexity region	2660	2684	N/A	INTRINSIC

Meta Mutation Damage Score

0.0582

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 97.8%
20x: 93.1%

Validation Efficiency

93% (39/42)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the homolog of the Drosophila melanogaster Nipped-B gene product and fungal Scc2-type sister chromatid cohesion proteins. The Drosophila protein facilitates enhancer-promoter communication of remote enhancers and plays a role in developmental regulation. It is also homologous to a family of chromosomal adherins with broad roles in sister chromatid cohesion, chromosome condensation, and DNA repair. The human protein has a bipartite nuclear targeting sequence and a putative HEAT repeat. Condensins, cohesins and other complexes with chromosome-related functions also contain HEAT repeats. Mutations in this gene result in Cornelia de Lange syndrome, a disorder characterized by dysmorphic facial features, growth delay, limb reduction defects, and mental retardation. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Nullizygous mice are embryonic lethal. Heterozygous null mice are growth-retarded and show various skeletal anomalies. Heterozygotes for a gene-trap allele are small and show craniofacial, heart, eye, hearing and behavioral defects, delayed bone maturation, reduced body fat, and postnatal mortality. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 40 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abat	C	T	16: 8,602,436		probably benign	Het
Ankmy2	A	G	12: 36,187,711	S270G	possibly damaging	Het
Anxa2	T	A	9: 69,476,149		probably null	Het
Arid1a	G	T	4: 133,681,524	P1891T	unknown	Het
Atn1	G	T	6: 124,746,176		probably benign	Het
Atp8b3	A	T	10: 80,520,323		probably null	Het
Cab39l	A	C	14: 59,506,270	K94N	possibly damaging	Het
Cacna2d2	G	T	9: 107,515,442	M528I	possibly damaging	Het
Ccnc	T	A	4: 21,747,578		probably null	Het
Clasp2	C	T	9: 113,892,444	T774I	probably damaging	Het
Cngb1	C	T	8: 95,297,759		probably benign	Het
Cpt1a	T	A	19: 3,362,156	F209L	probably damaging	Het
Cyp2j7	C	A	4: 96,227,667	D181Y	probably damaging	Het
Daam2	C	T	17: 49,469,376	E828K	probably damaging	Het
Ddr1	C	A	17: 35,687,222	R477L	probably benign	Het
Ech1	A	G	7: 28,825,885	T22A	probably benign	Het
Fbln5	T	C	12: 101,761,822	D294G	possibly damaging	Het
Fkbp15	T	C	4: 62,323,202	I569V	probably benign	Het
Hmcn1	G	T	1: 150,697,476	R2141S	possibly damaging	Het
Kat6b	T	C	14: 21,517,412	S180P	probably benign	Het
Lepr	G	A	4: 101,774,257	E655K	possibly damaging	Het
Mro	T	A	18: 73,872,033	L69Q	probably damaging	Het
Nkiras2	C	T	11: 100,625,035	R63W	probably damaging	Het
Nlrp4e	T	A	7: 23,320,633	S182T	possibly damaging	Het
Olfr548-ps1	A	T	7: 102,542,688	I251F	probably benign	Het
Otud4	T	C	8: 79,668,497	S553P	probably benign	Het
Pcdha4	T	C	18: 36,953,733	I323T	probably benign	Het
Polr1b	G	T	2: 129,123,261	A756S	probably damaging	Het
Prex2	A	T	1: 11,182,031	Y1100F	probably damaging	Het
Rnf219	T	C	14: 104,480,226	K237R	possibly damaging	Het
Serpinb6a	A	T	13: 33,918,259	S328T	probably damaging	Het
Srsf11	C	T	3: 158,023,344		probably benign	Het
Stxbp5	T	C	10: 9,899,254	T52A	probably damaging	Het
Taf3	A	T	2: 9,951,353	F515I	probably damaging	Het
Unc13b	A	G	4: 43,176,966		probably benign	Het
Vmn2r106	C	T	17: 20,268,463	C558Y	probably damaging	Het
Vps51	T	C	19: 6,070,917	Y322C	possibly damaging	Het
Wdr66	T	C	5: 123,326,533	L1268P	probably damaging	Het
Zfp735	G	A	11: 73,690,314	C59Y	possibly damaging	Het
Zfp759	A	G	13: 67,139,098		probably null	Het

Other mutations in Nipbl

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00417:Nipbl	APN	15	8366673	missense	probably damaging	0.98
IGL00712:Nipbl	APN	15	8369474	missense	probably damaging	0.97
IGL00789:Nipbl	APN	15	8296869	missense	probably damaging	1.00
IGL01025:Nipbl	APN	15	8350455	missense	possibly damaging	0.46
IGL01087:Nipbl	APN	15	8350497	missense	possibly damaging	0.67
IGL01474:Nipbl	APN	15	8311209	missense	possibly damaging	0.63
IGL01537:Nipbl	APN	15	8350539	missense	probably benign
IGL01723:Nipbl	APN	15	8335071	missense	possibly damaging	0.71
IGL01749:Nipbl	APN	15	8361821	missense	probably benign	0.13
IGL02398:Nipbl	APN	15	8327090	missense	probably damaging	1.00
IGL02437:Nipbl	APN	15	8359074	missense	probably damaging	1.00
IGL02450:Nipbl	APN	15	8343574	missense	probably damaging	0.99
IGL02477:Nipbl	APN	15	8323647	splice site	probably null
IGL02547:Nipbl	APN	15	8351598	missense	probably benign
IGL02678:Nipbl	APN	15	8351110	missense	possibly damaging	0.92
IGL02679:Nipbl	APN	15	8295553	missense	probably benign	0.34
IGL03003:Nipbl	APN	15	8350314	missense	probably damaging	1.00
IGL03117:Nipbl	APN	15	8332452	missense	probably damaging	1.00
IGL03162:Nipbl	APN	15	8338979	missense	probably benign	0.37
IGL03224:Nipbl	APN	15	8293085	missense	probably damaging	0.98
IGL03339:Nipbl	APN	15	8350876	missense	probably benign	0.12
R0346_Nipbl_297	UTSW	15	8360956	missense	probably damaging	0.99
R0347_Nipbl_476	UTSW	15	8350732	missense	probably benign
R3620_nipbl_616	UTSW	15	8333024	missense	probably damaging	0.99
R6388_Nipbl_651	UTSW	15	8300784	missense	probably damaging	0.99
R8441_Nipbl_224	UTSW	15	8293115	missense	probably benign	0.00
R0271:Nipbl	UTSW	15	8361737	missense	possibly damaging	0.76
R0346:Nipbl	UTSW	15	8360956	missense	probably damaging	0.99
R0347:Nipbl	UTSW	15	8350732	missense	probably benign
R0422:Nipbl	UTSW	15	8351628	missense	probably benign
R0486:Nipbl	UTSW	15	8338870	splice site	probably benign
R0652:Nipbl	UTSW	15	8303480	missense	probably benign	0.23
R0667:Nipbl	UTSW	15	8361004	missense	possibly damaging	0.86
R0689:Nipbl	UTSW	15	8293078	splice site	probably null
R0726:Nipbl	UTSW	15	8351555	missense	probably benign
R0881:Nipbl	UTSW	15	8307612	missense	probably damaging	0.98
R0904:Nipbl	UTSW	15	8361718	missense	probably benign
R0969:Nipbl	UTSW	15	8292228	missense	probably damaging	1.00
R1401:Nipbl	UTSW	15	8372173	missense	probably damaging	0.97
R1479:Nipbl	UTSW	15	8350289	missense	probably benign	0.00
R1495:Nipbl	UTSW	15	8351280	missense	probably benign	0.00
R1609:Nipbl	UTSW	15	8366664	missense	probably damaging	1.00
R1679:Nipbl	UTSW	15	8302912	missense	probably benign	0.31
R1756:Nipbl	UTSW	15	8338551	missense	possibly damaging	0.91
R1778:Nipbl	UTSW	15	8319488	missense	probably damaging	1.00
R1835:Nipbl	UTSW	15	8343517	missense	possibly damaging	0.80
R1883:Nipbl	UTSW	15	8327132	missense	probably damaging	1.00
R1914:Nipbl	UTSW	15	8343630	missense	possibly damaging	0.93
R1915:Nipbl	UTSW	15	8343630	missense	possibly damaging	0.93
R2030:Nipbl	UTSW	15	8350287	missense	probably damaging	1.00
R2046:Nipbl	UTSW	15	8324467	missense	probably benign	0.08
R2076:Nipbl	UTSW	15	8311207	missense	probably benign	0.11
R2163:Nipbl	UTSW	15	8336919	missense	probably damaging	0.99
R2170:Nipbl	UTSW	15	8293218	missense	probably damaging	1.00
R2425:Nipbl	UTSW	15	8351482	missense	probably benign	0.06
R2475:Nipbl	UTSW	15	8335006	missense	probably benign	0.05
R2484:Nipbl	UTSW	15	8323698	missense	probably damaging	0.99
R2970:Nipbl	UTSW	15	8311239	missense	probably damaging	1.00
R3116:Nipbl	UTSW	15	8343592	missense	probably benign	0.00
R3620:Nipbl	UTSW	15	8333024	missense	probably damaging	0.99
R3725:Nipbl	UTSW	15	8295661	missense	probably damaging	0.97
R3745:Nipbl	UTSW	15	8358874	missense	probably benign
R3902:Nipbl	UTSW	15	8350246	missense	possibly damaging	0.94
R3960:Nipbl	UTSW	15	8350534	missense	probably benign
R4164:Nipbl	UTSW	15	8338934	missense	probably benign	0.24
R4246:Nipbl	UTSW	15	8332432	missense	probably damaging	1.00
R4381:Nipbl	UTSW	15	8359206	missense	probably benign	0.00
R4394:Nipbl	UTSW	15	8361861	missense	probably benign	0.00
R4439:Nipbl	UTSW	15	8338724	missense	probably damaging	0.98
R4440:Nipbl	UTSW	15	8366658	missense	probably damaging	0.98
R4441:Nipbl	UTSW	15	8366658	missense	probably damaging	0.98
R4672:Nipbl	UTSW	15	8302984	missense	probably damaging	1.00
R4749:Nipbl	UTSW	15	8365829	missense	possibly damaging	0.95
R5300:Nipbl	UTSW	15	8351497	missense	probably benign
R5428:Nipbl	UTSW	15	8330296	missense	probably benign	0.00
R5641:Nipbl	UTSW	15	8366712	missense	possibly damaging	0.93
R5643:Nipbl	UTSW	15	8358907	missense	probably benign
R5644:Nipbl	UTSW	15	8358907	missense	probably benign
R5681:Nipbl	UTSW	15	8301382	missense	probably benign	0.22
R5741:Nipbl	UTSW	15	8324649	missense	possibly damaging	0.47
R5899:Nipbl	UTSW	15	8334844	splice site	probably null
R5970:Nipbl	UTSW	15	8296818	missense	probably benign	0.27
R6041:Nipbl	UTSW	15	8324264	missense	probably damaging	1.00
R6059:Nipbl	UTSW	15	8295568	missense	probably damaging	1.00
R6213:Nipbl	UTSW	15	8334906	missense	probably damaging	1.00
R6216:Nipbl	UTSW	15	8318383	missense	probably damaging	0.99
R6236:Nipbl	UTSW	15	8324580	missense	possibly damaging	0.88
R6267:Nipbl	UTSW	15	8300895	missense	possibly damaging	0.46
R6296:Nipbl	UTSW	15	8300895	missense	possibly damaging	0.46
R6388:Nipbl	UTSW	15	8300784	missense	probably damaging	0.99
R6707:Nipbl	UTSW	15	8324559	missense	probably benign	0.01
R6731:Nipbl	UTSW	15	8322590	missense	probably damaging	1.00
R6921:Nipbl	UTSW	15	8303485	missense	probably benign	0.28
R7239:Nipbl	UTSW	15	8292135	critical splice donor site	probably null
R7346:Nipbl	UTSW	15	8343606	missense	possibly damaging	0.94
R7485:Nipbl	UTSW	15	8330295	missense	probably benign	0.01
R7486:Nipbl	UTSW	15	8295636	missense	probably benign	0.25
R7598:Nipbl	UTSW	15	8343493	missense	probably benign	0.24
R7609:Nipbl	UTSW	15	8305872	missense	probably benign	0.27
R7674:Nipbl	UTSW	15	8293101	missense	probably benign	0.15
R7706:Nipbl	UTSW	15	8351526	missense	probably benign	0.01
R7760:Nipbl	UTSW	15	8358702	missense	probably damaging	1.00
R7766:Nipbl	UTSW	15	8296849	missense	probably benign	0.45
R7825:Nipbl	UTSW	15	8291487	missense	probably damaging	1.00
R7862:Nipbl	UTSW	15	8325752	missense	probably benign	0.06
R7958:Nipbl	UTSW	15	8311258	missense	possibly damaging	0.91
R8077:Nipbl	UTSW	15	8311250	missense	possibly damaging	0.49
R8119:Nipbl	UTSW	15	8359212	missense	probably benign	0.22
R8355:Nipbl	UTSW	15	8335044	missense	probably damaging	0.98
R8441:Nipbl	UTSW	15	8293115	missense	probably benign	0.00
R8455:Nipbl	UTSW	15	8335044	missense	probably damaging	0.98
R8717:Nipbl	UTSW	15	8338741	missense	probably benign
R8739:Nipbl	UTSW	15	8303420	missense	probably benign	0.08
R8854:Nipbl	UTSW	15	8300726	missense	probably damaging	1.00
R8887:Nipbl	UTSW	15	8361787	missense	probably damaging	1.00
R8942:Nipbl	UTSW	15	8351620	missense	probably benign
R8991:Nipbl	UTSW	15	8291513	missense	probably damaging	1.00
R9008:Nipbl	UTSW	15	8327124	missense	probably damaging	1.00
R9070:Nipbl	UTSW	15	8338731	missense	possibly damaging	0.82
R9116:Nipbl	UTSW	15	8350856	missense	probably benign	0.00
RF020:Nipbl	UTSW	15	8358934	missense	probably damaging	0.98
X0022:Nipbl	UTSW	15	8351715	missense	probably benign	0.05
X0027:Nipbl	UTSW	15	8323537	missense	probably damaging	1.00
Z1088:Nipbl	UTSW	15	8307882	missense	probably damaging	1.00
Z1176:Nipbl	UTSW	15	8338699	missense	possibly damaging	0.88
Z1177:Nipbl	UTSW	15	8336952	missense	probably damaging	1.00
Z1177:Nipbl	UTSW	15	8338680	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- TGTTTAGGCTCAACTACAGCGC -3'
(R):5'- TTCTCAGGAGACGGGTTCTAC -3'

Sequencing Primer
(F):5'- GCTCAACTACAGCGCTCTCG -3'
(R):5'- TTCTACGGGAAATGGGTCAAGGC -3'

Posted On

2018-05-24