Mutagenetix > Incidental Mutation

Incidental Mutation 'R6427:Nipbl'

518376

Institutional Source

Beutler Lab

Gene Symbol

Nipbl

Ensembl Gene

ENSMUSG00000022141

Gene Name

NIPBL cohesin loading factor

Synonyms

4921518A06Rik, 4933421G18Rik

MMRRC Submission

044566-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.965) question?

Stock #

R6427 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

8290617-8444463 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 8351565 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Histidine at position 581 (L581H)

Ref Sequence

ENSEMBL: ENSMUSP00000059385 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000052965]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000052965
AA Change: L581H

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000059385
Gene: ENSMUSG00000022141
AA Change: L581H

Domain	Start	End	E-Value	Type
low complexity region	22	41	N/A	INTRINSIC
low complexity region	322	338	N/A	INTRINSIC
low complexity region	367	376	N/A	INTRINSIC
low complexity region	447	462	N/A	INTRINSIC
low complexity region	473	490	N/A	INTRINSIC
low complexity region	639	652	N/A	INTRINSIC
low complexity region	1020	1037	N/A	INTRINSIC
low complexity region	1081	1097	N/A	INTRINSIC
low complexity region	1102	1107	N/A	INTRINSIC
low complexity region	1114	1139	N/A	INTRINSIC
low complexity region	1165	1176	N/A	INTRINSIC
low complexity region	1389	1396	N/A	INTRINSIC
low complexity region	1577	1586	N/A	INTRINSIC
coiled coil region	1628	1656	N/A	INTRINSIC
Pfam:Cohesin_HEAT	1788	1829	1.1e-14	PFAM
Pfam:Nipped-B_C	2269	2450	2.8e-68	PFAM
low complexity region	2477	2501	N/A	INTRINSIC
low complexity region	2502	2512	N/A	INTRINSIC
low complexity region	2538	2550	N/A	INTRINSIC
low complexity region	2626	2632	N/A	INTRINSIC
low complexity region	2660	2684	N/A	INTRINSIC

Meta Mutation Damage Score

0.0582

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 97.8%
20x: 93.1%

Validation Efficiency

93% (39/42)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the homolog of the Drosophila melanogaster Nipped-B gene product and fungal Scc2-type sister chromatid cohesion proteins. The Drosophila protein facilitates enhancer-promoter communication of remote enhancers and plays a role in developmental regulation. It is also homologous to a family of chromosomal adherins with broad roles in sister chromatid cohesion, chromosome condensation, and DNA repair. The human protein has a bipartite nuclear targeting sequence and a putative HEAT repeat. Condensins, cohesins and other complexes with chromosome-related functions also contain HEAT repeats. Mutations in this gene result in Cornelia de Lange syndrome, a disorder characterized by dysmorphic facial features, growth delay, limb reduction defects, and mental retardation. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Nullizygous mice are embryonic lethal. Heterozygous null mice are growth-retarded and show various skeletal anomalies. Heterozygotes for a gene-trap allele are small and show craniofacial, heart, eye, hearing and behavioral defects, delayed bone maturation, reduced body fat, and postnatal mortality. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 40 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abat	C	T	16: 8,602,436		probably benign	Het
Ankmy2	A	G	12: 36,187,711	S270G	possibly damaging	Het
Anxa2	T	A	9: 69,476,149		probably null	Het
Arid1a	G	T	4: 133,681,524	P1891T	unknown	Het
Atn1	G	T	6: 124,746,176		probably benign	Het
Atp8b3	A	T	10: 80,520,323		probably null	Het
Cab39l	A	C	14: 59,506,270	K94N	possibly damaging	Het
Cacna2d2	G	T	9: 107,515,442	M528I	possibly damaging	Het
Ccnc	T	A	4: 21,747,578		probably null	Het
Clasp2	C	T	9: 113,892,444	T774I	probably damaging	Het
Cngb1	C	T	8: 95,297,759		probably benign	Het
Cpt1a	T	A	19: 3,362,156	F209L	probably damaging	Het
Cyp2j7	C	A	4: 96,227,667	D181Y	probably damaging	Het
Daam2	C	T	17: 49,469,376	E828K	probably damaging	Het
Ddr1	C	A	17: 35,687,222	R477L	probably benign	Het
Ech1	A	G	7: 28,825,885	T22A	probably benign	Het
Fbln5	T	C	12: 101,761,822	D294G	possibly damaging	Het
Fkbp15	T	C	4: 62,323,202	I569V	probably benign	Het
Hmcn1	G	T	1: 150,697,476	R2141S	possibly damaging	Het
Kat6b	T	C	14: 21,517,412	S180P	probably benign	Het
Lepr	G	A	4: 101,774,257	E655K	possibly damaging	Het
Mro	T	A	18: 73,872,033	L69Q	probably damaging	Het
Nkiras2	C	T	11: 100,625,035	R63W	probably damaging	Het
Nlrp4e	T	A	7: 23,320,633	S182T	possibly damaging	Het
Olfr548-ps1	A	T	7: 102,542,688	I251F	probably benign	Het
Otud4	T	C	8: 79,668,497	S553P	probably benign	Het
Pcdha4	T	C	18: 36,953,733	I323T	probably benign	Het
Polr1b	G	T	2: 129,123,261	A756S	probably damaging	Het
Prex2	A	T	1: 11,182,031	Y1100F	probably damaging	Het
Rnf219	T	C	14: 104,480,226	K237R	possibly damaging	Het
Serpinb6a	A	T	13: 33,918,259	S328T	probably damaging	Het
Srsf11	C	T	3: 158,023,344		probably benign	Het
Stxbp5	T	C	10: 9,899,254	T52A	probably damaging	Het
Taf3	A	T	2: 9,951,353	F515I	probably damaging	Het
Unc13b	A	G	4: 43,176,966		probably benign	Het
Vmn2r106	C	T	17: 20,268,463	C558Y	probably damaging	Het
Vps51	T	C	19: 6,070,917	Y322C	possibly damaging	Het
Wdr66	T	C	5: 123,326,533	L1268P	probably damaging	Het
Zfp735	G	A	11: 73,690,314	C59Y	possibly damaging	Het
Zfp759	A	G	13: 67,139,098		probably null	Het

Other mutations in Nipbl

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00417:Nipbl	APN	15	8366673	missense	probably damaging	0.98
IGL00712:Nipbl	APN	15	8369474	missense	probably damaging	0.97
IGL00789:Nipbl	APN	15	8296869	missense	probably damaging	1.00
IGL01025:Nipbl	APN	15	8350455	missense	possibly damaging	0.46
IGL01087:Nipbl	APN	15	8350497	missense	possibly damaging	0.67
IGL01474:Nipbl	APN	15	8311209	missense	possibly damaging	0.63
IGL01537:Nipbl	APN	15	8350539	missense	probably benign
IGL01723:Nipbl	APN	15	8335071	missense	possibly damaging	0.71
IGL01749:Nipbl	APN	15	8361821	missense	probably benign	0.13
IGL02398:Nipbl	APN	15	8327090	missense	probably damaging	1.00
IGL02437:Nipbl	APN	15	8359074	missense	probably damaging	1.00
IGL02450:Nipbl	APN	15	8343574	missense	probably damaging	0.99
IGL02477:Nipbl	APN	15	8323647	splice site	probably null
IGL02547:Nipbl	APN	15	8351598	missense	probably benign
IGL02678:Nipbl	APN	15	8351110	missense	possibly damaging	0.92
IGL02679:Nipbl	APN	15	8295553	missense	probably benign	0.34
IGL03003:Nipbl	APN	15	8350314	missense	probably damaging	1.00
IGL03117:Nipbl	APN	15	8332452	missense	probably damaging	1.00
IGL03162:Nipbl	APN	15	8338979	missense	probably benign	0.37
IGL03224:Nipbl	APN	15	8293085	missense	probably damaging	0.98
IGL03339:Nipbl	APN	15	8350876	missense	probably benign	0.12
R0346_Nipbl_297	UTSW	15	8360956	missense	probably damaging	0.99
R0347_Nipbl_476	UTSW	15	8350732	missense	probably benign
R3620_nipbl_616	UTSW	15	8333024	missense	probably damaging	0.99
R6388_Nipbl_651	UTSW	15	8300784	missense	probably damaging	0.99
R8441_Nipbl_224	UTSW	15	8293115	missense	probably benign	0.00
R0271:Nipbl	UTSW	15	8361737	missense	possibly damaging	0.76
R0346:Nipbl	UTSW	15	8360956	missense	probably damaging	0.99
R0347:Nipbl	UTSW	15	8350732	missense	probably benign
R0422:Nipbl	UTSW	15	8351628	missense	probably benign
R0486:Nipbl	UTSW	15	8338870	splice site	probably benign
R0652:Nipbl	UTSW	15	8303480	missense	probably benign	0.23
R0667:Nipbl	UTSW	15	8361004	missense	possibly damaging	0.86
R0689:Nipbl	UTSW	15	8293078	splice site	probably null
R0726:Nipbl	UTSW	15	8351555	missense	probably benign
R0881:Nipbl	UTSW	15	8307612	missense	probably damaging	0.98
R0904:Nipbl	UTSW	15	8361718	missense	probably benign
R0969:Nipbl	UTSW	15	8292228	missense	probably damaging	1.00
R1401:Nipbl	UTSW	15	8372173	missense	probably damaging	0.97
R1479:Nipbl	UTSW	15	8350289	missense	probably benign	0.00
R1495:Nipbl	UTSW	15	8351280	missense	probably benign	0.00
R1609:Nipbl	UTSW	15	8366664	missense	probably damaging	1.00
R1679:Nipbl	UTSW	15	8302912	missense	probably benign	0.31
R1756:Nipbl	UTSW	15	8338551	missense	possibly damaging	0.91
R1778:Nipbl	UTSW	15	8319488	missense	probably damaging	1.00
R1835:Nipbl	UTSW	15	8343517	missense	possibly damaging	0.80
R1883:Nipbl	UTSW	15	8327132	missense	probably damaging	1.00
R1914:Nipbl	UTSW	15	8343630	missense	possibly damaging	0.93
R1915:Nipbl	UTSW	15	8343630	missense	possibly damaging	0.93
R2030:Nipbl	UTSW	15	8350287	missense	probably damaging	1.00
R2046:Nipbl	UTSW	15	8324467	missense	probably benign	0.08
R2076:Nipbl	UTSW	15	8311207	missense	probably benign	0.11
R2163:Nipbl	UTSW	15	8336919	missense	probably damaging	0.99
R2170:Nipbl	UTSW	15	8293218	missense	probably damaging	1.00
R2425:Nipbl	UTSW	15	8351482	missense	probably benign	0.06
R2475:Nipbl	UTSW	15	8335006	missense	probably benign	0.05
R2484:Nipbl	UTSW	15	8323698	missense	probably damaging	0.99
R2970:Nipbl	UTSW	15	8311239	missense	probably damaging	1.00
R3116:Nipbl	UTSW	15	8343592	missense	probably benign	0.00
R3620:Nipbl	UTSW	15	8333024	missense	probably damaging	0.99
R3725:Nipbl	UTSW	15	8295661	missense	probably damaging	0.97
R3745:Nipbl	UTSW	15	8358874	missense	probably benign
R3902:Nipbl	UTSW	15	8350246	missense	possibly damaging	0.94
R3960:Nipbl	UTSW	15	8350534	missense	probably benign
R4164:Nipbl	UTSW	15	8338934	missense	probably benign	0.24
R4246:Nipbl	UTSW	15	8332432	missense	probably damaging	1.00
R4381:Nipbl	UTSW	15	8359206	missense	probably benign	0.00
R4394:Nipbl	UTSW	15	8361861	missense	probably benign	0.00
R4439:Nipbl	UTSW	15	8338724	missense	probably damaging	0.98
R4440:Nipbl	UTSW	15	8366658	missense	probably damaging	0.98
R4441:Nipbl	UTSW	15	8366658	missense	probably damaging	0.98
R4672:Nipbl	UTSW	15	8302984	missense	probably damaging	1.00
R4749:Nipbl	UTSW	15	8365829	missense	possibly damaging	0.95
R5300:Nipbl	UTSW	15	8351497	missense	probably benign
R5428:Nipbl	UTSW	15	8330296	missense	probably benign	0.00
R5641:Nipbl	UTSW	15	8366712	missense	possibly damaging	0.93
R5643:Nipbl	UTSW	15	8358907	missense	probably benign
R5644:Nipbl	UTSW	15	8358907	missense	probably benign
R5681:Nipbl	UTSW	15	8301382	missense	probably benign	0.22
R5741:Nipbl	UTSW	15	8324649	missense	possibly damaging	0.47
R5899:Nipbl	UTSW	15	8334844	splice site	probably null
R5970:Nipbl	UTSW	15	8296818	missense	probably benign	0.27
R6041:Nipbl	UTSW	15	8324264	missense	probably damaging	1.00
R6059:Nipbl	UTSW	15	8295568	missense	probably damaging	1.00
R6213:Nipbl	UTSW	15	8334906	missense	probably damaging	1.00
R6216:Nipbl	UTSW	15	8318383	missense	probably damaging	0.99
R6236:Nipbl	UTSW	15	8324580	missense	possibly damaging	0.88
R6267:Nipbl	UTSW	15	8300895	missense	possibly damaging	0.46
R6296:Nipbl	UTSW	15	8300895	missense	possibly damaging	0.46
R6388:Nipbl	UTSW	15	8300784	missense	probably damaging	0.99
R6707:Nipbl	UTSW	15	8324559	missense	probably benign	0.01
R6731:Nipbl	UTSW	15	8322590	missense	probably damaging	1.00
R6921:Nipbl	UTSW	15	8303485	missense	probably benign	0.28
R7239:Nipbl	UTSW	15	8292135	critical splice donor site	probably null
R7346:Nipbl	UTSW	15	8343606	missense	possibly damaging	0.94
R7485:Nipbl	UTSW	15	8330295	missense	probably benign	0.01
R7486:Nipbl	UTSW	15	8295636	missense	probably benign	0.25
R7598:Nipbl	UTSW	15	8343493	missense	probably benign	0.24
R7609:Nipbl	UTSW	15	8305872	missense	probably benign	0.27
R7674:Nipbl	UTSW	15	8293101	missense	probably benign	0.15
R7706:Nipbl	UTSW	15	8351526	missense	probably benign	0.01
R7760:Nipbl	UTSW	15	8358702	missense	probably damaging	1.00
R7766:Nipbl	UTSW	15	8296849	missense	probably benign	0.45
R7825:Nipbl	UTSW	15	8291487	missense	probably damaging	1.00
R7862:Nipbl	UTSW	15	8325752	missense	probably benign	0.06
R7958:Nipbl	UTSW	15	8311258	missense	possibly damaging	0.91
R8077:Nipbl	UTSW	15	8311250	missense	possibly damaging	0.49
R8119:Nipbl	UTSW	15	8359212	missense	probably benign	0.22
R8355:Nipbl	UTSW	15	8335044	missense	probably damaging	0.98
R8441:Nipbl	UTSW	15	8293115	missense	probably benign	0.00
R8455:Nipbl	UTSW	15	8335044	missense	probably damaging	0.98
R8717:Nipbl	UTSW	15	8338741	missense	probably benign
R8739:Nipbl	UTSW	15	8303420	missense	probably benign	0.08
R8854:Nipbl	UTSW	15	8300726	missense	probably damaging	1.00
R8887:Nipbl	UTSW	15	8361787	missense	probably damaging	1.00
R8942:Nipbl	UTSW	15	8351620	missense	probably benign
R8991:Nipbl	UTSW	15	8291513	missense	probably damaging	1.00
R9008:Nipbl	UTSW	15	8327124	missense	probably damaging	1.00
R9070:Nipbl	UTSW	15	8338731	missense	possibly damaging	0.82
R9116:Nipbl	UTSW	15	8350856	missense	probably benign	0.00
R9622:Nipbl	UTSW	15	8336889	missense	probably benign	0.27
R9778:Nipbl	UTSW	15	8291548	missense	probably benign	0.10
RF020:Nipbl	UTSW	15	8358934	missense	probably damaging	0.98
X0022:Nipbl	UTSW	15	8351715	missense	probably benign	0.05
X0027:Nipbl	UTSW	15	8323537	missense	probably damaging	1.00
Z1088:Nipbl	UTSW	15	8307882	missense	probably damaging	1.00
Z1176:Nipbl	UTSW	15	8338699	missense	possibly damaging	0.88
Z1177:Nipbl	UTSW	15	8336952	missense	probably damaging	1.00
Z1177:Nipbl	UTSW	15	8338680	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- TGTTTAGGCTCAACTACAGCGC -3'
(R):5'- TTCTCAGGAGACGGGTTCTAC -3'

Sequencing Primer
(F):5'- GCTCAACTACAGCGCTCTCG -3'
(R):5'- TTCTACGGGAAATGGGTCAAGGC -3'

Posted On

2018-05-24