Incidental Mutation 'R6427:Abat'
ID518377
Institutional Source Beutler Lab
Gene Symbol Abat
Ensembl Gene ENSMUSG00000057880
Gene Name4-aminobutyrate aminotransferase
SynonymsGABA-T, 9630038C02Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6427 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location8513429-8621568 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) C to T at 8602436 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000116686 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065987] [ENSMUST00000115838] [ENSMUST00000115839] [ENSMUST00000138987]
Predicted Effect probably benign
Transcript: ENSMUST00000065987
SMART Domains Protein: ENSMUSP00000063548
Gene: ENSMUSG00000057880

DomainStartEndE-ValueType
Pfam:Aminotran_3 65 496 1.7e-136 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000115838
AA Change: H200Y
SMART Domains Protein: ENSMUSP00000111504
Gene: ENSMUSG00000057880
AA Change: H200Y

DomainStartEndE-ValueType
Pfam:Aminotran_3 76 186 5e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115839
SMART Domains Protein: ENSMUSP00000111505
Gene: ENSMUSG00000057880

DomainStartEndE-ValueType
Pfam:Aminotran_3 76 323 3.2e-64 PFAM
Pfam:Aminotran_3 317 390 1.8e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000138987
SMART Domains Protein: ENSMUSP00000116686
Gene: ENSMUSG00000057880

DomainStartEndE-ValueType
Pfam:Aminotran_3 53 232 1.9e-32 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000144444
AA Change: H104Y
SMART Domains Protein: ENSMUSP00000121881
Gene: ENSMUSG00000057880
AA Change: H104Y

DomainStartEndE-ValueType
Pfam:Aminotran_3 3 93 1.3e-19 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 93.1%
Validation Efficiency 93% (39/42)
MGI Phenotype FUNCTION: The encoded gene product is responsible for catabolism of gamma-aminobutyric acid (GABA), a mostly inhibitory neurotransmitter in the central nervous system, into succinic semialdehyde. Deficiency of this encoded protein includes psychomotor retardation, hypotonia, hyperreflexia, lethargy, refractory seizures, and EEG abnormalities. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2010]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankmy2 A G 12: 36,187,711 S270G possibly damaging Het
Anxa2 T A 9: 69,476,149 probably null Het
Arid1a G T 4: 133,681,524 P1891T unknown Het
Atn1 G T 6: 124,746,176 probably benign Het
Atp8b3 A T 10: 80,520,323 probably null Het
Cab39l A C 14: 59,506,270 K94N possibly damaging Het
Cacna2d2 G T 9: 107,515,442 M528I possibly damaging Het
Ccnc T A 4: 21,747,578 probably null Het
Clasp2 C T 9: 113,892,444 T774I probably damaging Het
Cngb1 C T 8: 95,297,759 probably benign Het
Cpt1a T A 19: 3,362,156 F209L probably damaging Het
Cyp2j7 C A 4: 96,227,667 D181Y probably damaging Het
Daam2 C T 17: 49,469,376 E828K probably damaging Het
Ddr1 C A 17: 35,687,222 R477L probably benign Het
Ech1 A G 7: 28,825,885 T22A probably benign Het
Fbln5 T C 12: 101,761,822 D294G possibly damaging Het
Fkbp15 T C 4: 62,323,202 I569V probably benign Het
Hmcn1 G T 1: 150,697,476 R2141S possibly damaging Het
Kat6b T C 14: 21,517,412 S180P probably benign Het
Lepr G A 4: 101,774,257 E655K possibly damaging Het
Mro T A 18: 73,872,033 L69Q probably damaging Het
Nipbl A T 15: 8,351,565 L581H probably benign Het
Nkiras2 C T 11: 100,625,035 R63W probably damaging Het
Nlrp4e T A 7: 23,320,633 S182T possibly damaging Het
Olfr548-ps1 A T 7: 102,542,688 I251F probably benign Het
Otud4 T C 8: 79,668,497 S553P probably benign Het
Pcdha4 T C 18: 36,953,733 I323T probably benign Het
Polr1b G T 2: 129,123,261 A756S probably damaging Het
Prex2 A T 1: 11,182,031 Y1100F probably damaging Het
Rnf219 T C 14: 104,480,226 K237R possibly damaging Het
Serpinb6a A T 13: 33,918,259 S328T probably damaging Het
Srsf11 C T 3: 158,023,344 probably benign Het
Stxbp5 T C 10: 9,899,254 T52A probably damaging Het
Taf3 A T 2: 9,951,353 F515I probably damaging Het
Unc13b A G 4: 43,176,966 probably benign Het
Vmn2r106 C T 17: 20,268,463 C558Y probably damaging Het
Vps51 T C 19: 6,070,917 Y322C possibly damaging Het
Wdr66 T C 5: 123,326,533 L1268P probably damaging Het
Zfp735 G A 11: 73,690,314 C59Y possibly damaging Het
Zfp759 A G 13: 67,139,098 probably null Het
Other mutations in Abat
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01635:Abat APN 16 8614046 missense probably benign 0.04
IGL01642:Abat APN 16 8600919 missense possibly damaging 0.81
IGL02024:Abat APN 16 8611136 missense probably damaging 1.00
IGL02071:Abat APN 16 8582812 missense probably damaging 1.00
R2853:Abat UTSW 16 8600968 missense probably damaging 1.00
R4839:Abat UTSW 16 8583648 intron probably benign
R4895:Abat UTSW 16 8615962 missense probably benign 0.00
R5378:Abat UTSW 16 8578277 missense probably benign 0.00
R5804:Abat UTSW 16 8578236 nonsense probably null
R6012:Abat UTSW 16 8582827 missense probably damaging 1.00
R6113:Abat UTSW 16 8572900 missense probably benign 0.01
R6122:Abat UTSW 16 8605550 missense probably benign 0.01
R6190:Abat UTSW 16 8605608 missense probably damaging 1.00
R6328:Abat UTSW 16 8602436 intron probably benign
R6382:Abat UTSW 16 8600986 missense probably benign 0.11
R6426:Abat UTSW 16 8602436 intron probably benign
R6428:Abat UTSW 16 8602436 intron probably benign
R6738:Abat UTSW 16 8602436 intron probably benign
R7009:Abat UTSW 16 8602367 missense probably benign 0.05
R7019:Abat UTSW 16 8618531 nonsense probably null
R7310:Abat UTSW 16 8605593 missense probably null 0.01
R7499:Abat UTSW 16 8603754 critical splice donor site probably null
R8122:Abat UTSW 16 8615897 missense probably damaging 1.00
R8138:Abat UTSW 16 8600965 missense probably benign 0.05
Z1177:Abat UTSW 16 8603753 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AAGTACTCATCCTGGACCCC -3'
(R):5'- GTTGAAATGGAACGATTTATGGCAG -3'

Sequencing Primer
(F):5'- ATCCTGGACCCCTCTGCAG -3'
(R):5'- CTGATCAGGACTGCCTAGGTATAC -3'
Posted On2018-05-24