Incidental Mutation 'R6427:Daam2'
ID518380
Institutional Source Beutler Lab
Gene Symbol Daam2
Ensembl Gene ENSMUSG00000040260
Gene Namedishevelled associated activator of morphogenesis 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6427 (G1)
Quality Score158.009
Status Validated
Chromosome17
Chromosomal Location49456022-49564343 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 49469376 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 828 (E828K)
Ref Sequence ENSEMBL: ENSMUSP00000052085 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057610]
Predicted Effect probably damaging
Transcript: ENSMUST00000057610
AA Change: E828K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000052085
Gene: ENSMUSG00000040260
AA Change: E828K

DomainStartEndE-ValueType
Drf_GBD 40 228 4.89e-61 SMART
Drf_FH3 231 429 1.19e-73 SMART
Blast:FH2 476 513 4e-10 BLAST
low complexity region 514 534 N/A INTRINSIC
low complexity region 539 576 N/A INTRINSIC
FH2 595 1085 7.36e-99 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224954
Meta Mutation Damage Score 0.1335 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 93.1%
Validation Efficiency 93% (39/42)
MGI Phenotype PHENOTYPE: Homozygous KO in combination with homozygous Daam1 conditional KO increases the severity of the heart phenotype (abnormal ventricular morphology and pressure) of the Daam1 single KO. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abat C T 16: 8,602,436 probably benign Het
Ankmy2 A G 12: 36,187,711 S270G possibly damaging Het
Anxa2 T A 9: 69,476,149 probably null Het
Arid1a G T 4: 133,681,524 P1891T unknown Het
Atn1 G T 6: 124,746,176 probably benign Het
Atp8b3 A T 10: 80,520,323 probably null Het
Cab39l A C 14: 59,506,270 K94N possibly damaging Het
Cacna2d2 G T 9: 107,515,442 M528I possibly damaging Het
Ccnc T A 4: 21,747,578 probably null Het
Clasp2 C T 9: 113,892,444 T774I probably damaging Het
Cngb1 C T 8: 95,297,759 probably benign Het
Cpt1a T A 19: 3,362,156 F209L probably damaging Het
Cyp2j7 C A 4: 96,227,667 D181Y probably damaging Het
Ddr1 C A 17: 35,687,222 R477L probably benign Het
Ech1 A G 7: 28,825,885 T22A probably benign Het
Fbln5 T C 12: 101,761,822 D294G possibly damaging Het
Fkbp15 T C 4: 62,323,202 I569V probably benign Het
Hmcn1 G T 1: 150,697,476 R2141S possibly damaging Het
Kat6b T C 14: 21,517,412 S180P probably benign Het
Lepr G A 4: 101,774,257 E655K possibly damaging Het
Mro T A 18: 73,872,033 L69Q probably damaging Het
Nipbl A T 15: 8,351,565 L581H probably benign Het
Nkiras2 C T 11: 100,625,035 R63W probably damaging Het
Nlrp4e T A 7: 23,320,633 S182T possibly damaging Het
Olfr548-ps1 A T 7: 102,542,688 I251F probably benign Het
Otud4 T C 8: 79,668,497 S553P probably benign Het
Pcdha4 T C 18: 36,953,733 I323T probably benign Het
Polr1b G T 2: 129,123,261 A756S probably damaging Het
Prex2 A T 1: 11,182,031 Y1100F probably damaging Het
Rnf219 T C 14: 104,480,226 K237R possibly damaging Het
Serpinb6a A T 13: 33,918,259 S328T probably damaging Het
Srsf11 C T 3: 158,023,344 probably benign Het
Stxbp5 T C 10: 9,899,254 T52A probably damaging Het
Taf3 A T 2: 9,951,353 F515I probably damaging Het
Unc13b A G 4: 43,176,966 probably benign Het
Vmn2r106 C T 17: 20,268,463 C558Y probably damaging Het
Vps51 T C 19: 6,070,917 Y322C possibly damaging Het
Wdr66 T C 5: 123,326,533 L1268P probably damaging Het
Zfp735 G A 11: 73,690,314 C59Y possibly damaging Het
Zfp759 A G 13: 67,139,098 probably null Het
Other mutations in Daam2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02150:Daam2 APN 17 49490304 missense possibly damaging 0.82
IGL02373:Daam2 APN 17 49473380 missense probably damaging 1.00
IGL02626:Daam2 APN 17 49490254 missense possibly damaging 0.46
IGL02793:Daam2 APN 17 49464028 missense probably damaging 1.00
IGL02861:Daam2 APN 17 49469427 missense probably damaging 1.00
IGL02875:Daam2 APN 17 49464028 missense probably damaging 1.00
IGL03370:Daam2 APN 17 49486501 missense probably benign 0.19
R0145:Daam2 UTSW 17 49480778 missense probably benign
R0310:Daam2 UTSW 17 49463924 critical splice donor site probably null
R0362:Daam2 UTSW 17 49480785 splice site probably null
R0423:Daam2 UTSW 17 49469421 nonsense probably null
R0883:Daam2 UTSW 17 49498883 utr 5 prime probably benign
R0928:Daam2 UTSW 17 49488227 missense probably benign 0.30
R1444:Daam2 UTSW 17 49480751 missense possibly damaging 0.89
R1559:Daam2 UTSW 17 49496120 splice site probably benign
R1733:Daam2 UTSW 17 49490203 missense possibly damaging 0.60
R1919:Daam2 UTSW 17 49485457 missense probably benign 0.00
R1930:Daam2 UTSW 17 49462213 splice site probably null
R1968:Daam2 UTSW 17 49483060 missense probably damaging 1.00
R2520:Daam2 UTSW 17 49480757 nonsense probably null
R3004:Daam2 UTSW 17 49460654 missense probably damaging 0.98
R3726:Daam2 UTSW 17 49469738 missense probably damaging 1.00
R3854:Daam2 UTSW 17 49458596 missense probably benign
R4833:Daam2 UTSW 17 49490145 missense possibly damaging 0.91
R4878:Daam2 UTSW 17 49460710 missense probably damaging 1.00
R5015:Daam2 UTSW 17 49476522 missense probably damaging 1.00
R5106:Daam2 UTSW 17 49476461 missense probably damaging 1.00
R5184:Daam2 UTSW 17 49494391 missense possibly damaging 0.50
R5419:Daam2 UTSW 17 49480754 missense possibly damaging 0.95
R5529:Daam2 UTSW 17 49459057 missense probably benign
R5974:Daam2 UTSW 17 49464473 missense probably damaging 1.00
R5979:Daam2 UTSW 17 49459204 missense possibly damaging 0.47
R6032:Daam2 UTSW 17 49486497 missense probably damaging 1.00
R6032:Daam2 UTSW 17 49486497 missense probably damaging 1.00
R6050:Daam2 UTSW 17 49486502 missense possibly damaging 0.78
R6180:Daam2 UTSW 17 49469666 missense probably damaging 0.99
R6225:Daam2 UTSW 17 49494439 missense probably damaging 0.98
R6385:Daam2 UTSW 17 49463936 missense probably damaging 1.00
R6426:Daam2 UTSW 17 49469376 missense probably damaging 1.00
R6428:Daam2 UTSW 17 49469376 missense probably damaging 1.00
R6539:Daam2 UTSW 17 49469711 missense probably damaging 1.00
R7090:Daam2 UTSW 17 49482945 missense probably damaging 0.99
R7108:Daam2 UTSW 17 49460674 missense probably damaging 1.00
R7487:Daam2 UTSW 17 49486482 missense probably benign 0.03
R7599:Daam2 UTSW 17 49480727 nonsense probably null
R7763:Daam2 UTSW 17 49490022 missense probably benign 0.04
R8039:Daam2 UTSW 17 49464538 missense probably damaging 1.00
V1662:Daam2 UTSW 17 49464601 missense possibly damaging 0.85
Z1177:Daam2 UTSW 17 49464620 missense probably damaging 1.00
Z1177:Daam2 UTSW 17 49489016 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATCATGTGATTGGCATGTAAGCC -3'
(R):5'- AATGGGATTCAGGCAGCAGC -3'

Sequencing Primer
(F):5'- CTCAGCTACCTAGTAAGCTGGAAG -3'
(R):5'- ATTCAGGCAGCAGCTCTGG -3'
Posted On2018-05-24