Incidental Mutation 'R6427:Pcdha4'
ID518381
Institutional Source Beutler Lab
Gene Symbol Pcdha4
Ensembl Gene ENSMUSG00000104252
Gene Nameprotocadherin alpha 4
SynonymsCnr1, Crnr1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.121) question?
Stock #R6427 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location36952648-37187661 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 36953733 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 323 (I323T)
Ref Sequence ENSEMBL: ENSMUSP00000141408 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070797] [ENSMUST00000115661] [ENSMUST00000115662] [ENSMUST00000192295] [ENSMUST00000192503] [ENSMUST00000192512] [ENSMUST00000193839] [ENSMUST00000195590]
Predicted Effect probably benign
Transcript: ENSMUST00000070797
SMART Domains Protein: ENSMUSP00000068828
Gene: ENSMUSG00000103442

DomainStartEndE-ValueType
CA 22 132 3.09e-2 SMART
CA 156 241 6.14e-20 SMART
CA 265 349 3.92e-27 SMART
CA 373 454 4.94e-24 SMART
CA 478 564 1e-24 SMART
CA 592 672 4.55e-14 SMART
transmembrane domain 694 716 N/A INTRINSIC
Pfam:Cadherin_tail 797 931 5.3e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115661
AA Change: I323T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000111325
Gene: ENSMUSG00000103458
AA Change: I323T

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 563 1.42e-24 SMART
CA 594 674 4.12e-12 SMART
low complexity region 706 721 N/A INTRINSIC
Pfam:Cadherin_tail 796 930 3.9e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115662
SMART Domains Protein: ENSMUSP00000111326
Gene: ENSMUSG00000104148

DomainStartEndE-ValueType
CA 45 131 6.34e-2 SMART
CA 155 240 2.98e-18 SMART
CA 264 348 2.17e-29 SMART
CA 372 453 2.84e-24 SMART
CA 477 563 5.02e-25 SMART
CA 594 675 8.16e-16 SMART
transmembrane domain 695 717 N/A INTRINSIC
low complexity region 916 940 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000192295
AA Change: I323T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000142103
Gene: ENSMUSG00000104252
AA Change: I323T

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 568 5.38e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000192503
SMART Domains Protein: ENSMUSP00000141989
Gene: ENSMUSG00000102312

DomainStartEndE-ValueType
low complexity region 11 17 N/A INTRINSIC
CA 42 128 3.78e-2 SMART
CA 152 237 8.94e-22 SMART
CA 261 345 3.74e-24 SMART
CA 369 450 1.09e-25 SMART
CA 474 560 1.42e-24 SMART
CA 588 670 2.96e-13 SMART
transmembrane domain 692 714 N/A INTRINSIC
low complexity region 910 934 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000192512
AA Change: I323T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000141408
Gene: ENSMUSG00000104252
AA Change: I323T

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 563 1.42e-24 SMART
CA 594 674 4.12e-12 SMART
low complexity region 706 721 N/A INTRINSIC
low complexity region 915 939 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193839
SMART Domains Protein: ENSMUSP00000142308
Gene: ENSMUSG00000103442

DomainStartEndE-ValueType
CA 22 132 3.09e-2 SMART
CA 156 241 6.14e-20 SMART
CA 265 349 3.92e-27 SMART
CA 373 454 4.94e-24 SMART
CA 478 564 1e-24 SMART
CA 592 672 4.55e-14 SMART
transmembrane domain 694 716 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194001
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194235
Predicted Effect probably benign
Transcript: ENSMUST00000195590
SMART Domains Protein: ENSMUSP00000141355
Gene: ENSMUSG00000104148

DomainStartEndE-ValueType
CA 45 131 6.34e-2 SMART
CA 155 240 2.98e-18 SMART
CA 264 348 2.17e-29 SMART
CA 372 453 2.84e-24 SMART
CA 477 563 5.02e-25 SMART
CA 594 675 8.16e-16 SMART
transmembrane domain 695 717 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 93.1%
Validation Efficiency 93% (39/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the protocadherin alpha gene cluster, one of three related gene clusters tandemly linked on chromosome five that demonstrate an unusual genomic organization similar to that of B-cell and T-cell receptor gene clusters. The alpha gene cluster is composed of 15 cadherin superfamily genes related to the mouse CNR genes and consists of 13 highly similar and 2 more distantly related coding sequences. The tandem array of 15 N-terminal exons, or variable exons, are followed by downstream C-terminal exons, or constant exons, which are shared by all genes in the cluster. The large, uninterrupted N-terminal exons each encode six cadherin ectodomains while the C-terminal exons encode the cytoplasmic domain. These neural cadherin-like cell adhesion proteins are integral plasma membrane proteins that most likely play a critical role in the establishment and function of specific cell-cell connections in the brain. Alternative splicing has been observed and additional variants have been suggested but their full-length nature has yet to be determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abat C T 16: 8,602,436 probably benign Het
Ankmy2 A G 12: 36,187,711 S270G possibly damaging Het
Anxa2 T A 9: 69,476,149 probably null Het
Arid1a G T 4: 133,681,524 P1891T unknown Het
Atn1 G T 6: 124,746,176 probably benign Het
Atp8b3 A T 10: 80,520,323 probably null Het
Cab39l A C 14: 59,506,270 K94N possibly damaging Het
Cacna2d2 G T 9: 107,515,442 M528I possibly damaging Het
Ccnc T A 4: 21,747,578 probably null Het
Clasp2 C T 9: 113,892,444 T774I probably damaging Het
Cngb1 C T 8: 95,297,759 probably benign Het
Cpt1a T A 19: 3,362,156 F209L probably damaging Het
Cyp2j7 C A 4: 96,227,667 D181Y probably damaging Het
Daam2 C T 17: 49,469,376 E828K probably damaging Het
Ddr1 C A 17: 35,687,222 R477L probably benign Het
Ech1 A G 7: 28,825,885 T22A probably benign Het
Fbln5 T C 12: 101,761,822 D294G possibly damaging Het
Fkbp15 T C 4: 62,323,202 I569V probably benign Het
Hmcn1 G T 1: 150,697,476 R2141S possibly damaging Het
Kat6b T C 14: 21,517,412 S180P probably benign Het
Lepr G A 4: 101,774,257 E655K possibly damaging Het
Mro T A 18: 73,872,033 L69Q probably damaging Het
Nipbl A T 15: 8,351,565 L581H probably benign Het
Nkiras2 C T 11: 100,625,035 R63W probably damaging Het
Nlrp4e T A 7: 23,320,633 S182T possibly damaging Het
Olfr548-ps1 A T 7: 102,542,688 I251F probably benign Het
Otud4 T C 8: 79,668,497 S553P probably benign Het
Polr1b G T 2: 129,123,261 A756S probably damaging Het
Prex2 A T 1: 11,182,031 Y1100F probably damaging Het
Rnf219 T C 14: 104,480,226 K237R possibly damaging Het
Serpinb6a A T 13: 33,918,259 S328T probably damaging Het
Srsf11 C T 3: 158,023,344 probably benign Het
Stxbp5 T C 10: 9,899,254 T52A probably damaging Het
Taf3 A T 2: 9,951,353 F515I probably damaging Het
Unc13b A G 4: 43,176,966 probably benign Het
Vmn2r106 C T 17: 20,268,463 C558Y probably damaging Het
Vps51 T C 19: 6,070,917 Y322C possibly damaging Het
Wdr66 T C 5: 123,326,533 L1268P probably damaging Het
Zfp735 G A 11: 73,690,314 C59Y possibly damaging Het
Zfp759 A G 13: 67,139,098 probably null Het
Other mutations in Pcdha4
AlleleSourceChrCoordTypePredicted EffectPPH Score
R2570:Pcdha4 UTSW 18 36953612 missense probably benign 0.00
R3114:Pcdha4 UTSW 18 36953550 missense probably benign 0.02
R3115:Pcdha4 UTSW 18 36953550 missense probably benign 0.02
R4154:Pcdha4 UTSW 18 36953586 splice site probably null
R4381:Pcdha4 UTSW 18 36952875 missense probably damaging 1.00
R4389:Pcdha4 UTSW 18 36954789 missense probably benign
R4493:Pcdha4 UTSW 18 36954591 missense possibly damaging 0.80
R4801:Pcdha4 UTSW 18 36953955 nonsense probably null
R4802:Pcdha4 UTSW 18 36953955 nonsense probably null
R4827:Pcdha4 UTSW 18 36953198 missense probably damaging 1.00
R4928:Pcdha4 UTSW 18 36954816 missense probably benign 0.01
R5001:Pcdha4 UTSW 18 36954948 missense probably benign
R5330:Pcdha4 UTSW 18 36954702 missense probably benign 0.01
R5331:Pcdha4 UTSW 18 36954702 missense probably benign 0.01
R5540:Pcdha4 UTSW 18 36954837 missense probably benign 0.01
R5587:Pcdha4 UTSW 18 36954822 missense probably benign
R5931:Pcdha4 UTSW 18 36954755 missense probably damaging 1.00
R6249:Pcdha4 UTSW 18 36953676 missense probably damaging 0.99
R6612:Pcdha4 UTSW 18 36954978 missense probably benign 0.00
R6616:Pcdha4 UTSW 18 36953900 missense probably benign
R7030:Pcdha4 UTSW 18 36954027 missense probably damaging 1.00
R7198:Pcdha4 UTSW 18 36953560 missense probably damaging 0.99
R7411:Pcdha4 UTSW 18 36953058 missense probably benign 0.01
R7491:Pcdha4 UTSW 18 36954636 missense probably damaging 1.00
R7513:Pcdha4 UTSW 18 36953339 missense probably damaging 1.00
R7544:Pcdha4 UTSW 18 36953723 missense probably benign 0.05
R7735:Pcdha4 UTSW 18 36952908 missense probably damaging 1.00
R7753:Pcdha4 UTSW 18 36953301 missense possibly damaging 0.49
R8104:Pcdha4 UTSW 18 36954053 missense probably damaging 1.00
R8239:Pcdha4 UTSW 18 36953075 missense probably damaging 1.00
R8767:Pcdha4 UTSW 18 36953852 missense possibly damaging 0.73
R8802:Pcdha4 UTSW 18 36954158 missense possibly damaging 0.91
R8869:Pcdha4 UTSW 18 36952958 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ATGCCTCAGATTTAGACGAAGGG -3'
(R):5'- ACCAACTTGAAGGGGACATG -3'

Sequencing Primer
(F):5'- CTCAGATTTAGACGAAGGGGTAAATG -3'
(R):5'- ACTTGTCAGGGAGCAGGTCAC -3'
Posted On2018-05-24