Incidental Mutation 'R6427:Cpt1a'
ID518383
Institutional Source Beutler Lab
Gene Symbol Cpt1a
Ensembl Gene ENSMUSG00000024900
Gene Namecarnitine palmitoyltransferase 1a, liver
SynonymsL-CPT I, CPTI, Cpt1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6427 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location3323301-3385732 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 3362156 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 209 (F209L)
Ref Sequence ENSEMBL: ENSMUSP00000025835 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025835]
Predicted Effect probably damaging
Transcript: ENSMUST00000025835
AA Change: F209L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000025835
Gene: ENSMUSG00000024900
AA Change: F209L

DomainStartEndE-ValueType
Pfam:CPT_N 1 47 2.3e-30 PFAM
transmembrane domain 49 71 N/A INTRINSIC
transmembrane domain 104 126 N/A INTRINSIC
Pfam:Carn_acyltransf 171 762 6e-186 PFAM
Meta Mutation Damage Score 0.9507 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 93.1%
Validation Efficiency 93% (39/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The mitochondrial oxidation of long-chain fatty acids is initiated by the sequential action of carnitine palmitoyltransferase I (which is located in the outer membrane and is detergent-labile) and carnitine palmitoyltransferase II (which is located in the inner membrane and is detergent-stable), together with a carnitine-acylcarnitine translocase. CPT I is the key enzyme in the carnitine-dependent transport across the mitochondrial inner membrane and its deficiency results in a decreased rate of fatty acid beta-oxidation. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display embryonic lethality. Heterozygous null mice display decreased serum glucose and increased serum free fatty acid levels after fasting. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abat C T 16: 8,602,436 probably benign Het
Ankmy2 A G 12: 36,187,711 S270G possibly damaging Het
Anxa2 T A 9: 69,476,149 probably null Het
Arid1a G T 4: 133,681,524 P1891T unknown Het
Atn1 G T 6: 124,746,176 probably benign Het
Atp8b3 A T 10: 80,520,323 probably null Het
Cab39l A C 14: 59,506,270 K94N possibly damaging Het
Cacna2d2 G T 9: 107,515,442 M528I possibly damaging Het
Ccnc T A 4: 21,747,578 probably null Het
Clasp2 C T 9: 113,892,444 T774I probably damaging Het
Cngb1 C T 8: 95,297,759 probably benign Het
Cyp2j7 C A 4: 96,227,667 D181Y probably damaging Het
Daam2 C T 17: 49,469,376 E828K probably damaging Het
Ddr1 C A 17: 35,687,222 R477L probably benign Het
Ech1 A G 7: 28,825,885 T22A probably benign Het
Fbln5 T C 12: 101,761,822 D294G possibly damaging Het
Fkbp15 T C 4: 62,323,202 I569V probably benign Het
Hmcn1 G T 1: 150,697,476 R2141S possibly damaging Het
Kat6b T C 14: 21,517,412 S180P probably benign Het
Lepr G A 4: 101,774,257 E655K possibly damaging Het
Mro T A 18: 73,872,033 L69Q probably damaging Het
Nipbl A T 15: 8,351,565 L581H probably benign Het
Nkiras2 C T 11: 100,625,035 R63W probably damaging Het
Nlrp4e T A 7: 23,320,633 S182T possibly damaging Het
Olfr548-ps1 A T 7: 102,542,688 I251F probably benign Het
Otud4 T C 8: 79,668,497 S553P probably benign Het
Pcdha4 T C 18: 36,953,733 I323T probably benign Het
Polr1b G T 2: 129,123,261 A756S probably damaging Het
Prex2 A T 1: 11,182,031 Y1100F probably damaging Het
Rnf219 T C 14: 104,480,226 K237R possibly damaging Het
Serpinb6a A T 13: 33,918,259 S328T probably damaging Het
Srsf11 C T 3: 158,023,344 probably benign Het
Stxbp5 T C 10: 9,899,254 T52A probably damaging Het
Taf3 A T 2: 9,951,353 F515I probably damaging Het
Unc13b A G 4: 43,176,966 probably benign Het
Vmn2r106 C T 17: 20,268,463 C558Y probably damaging Het
Vps51 T C 19: 6,070,917 Y322C possibly damaging Het
Wdr66 T C 5: 123,326,533 L1268P probably damaging Het
Zfp735 G A 11: 73,690,314 C59Y possibly damaging Het
Zfp759 A G 13: 67,139,098 probably null Het
Other mutations in Cpt1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00785:Cpt1a APN 19 3366389 missense possibly damaging 0.85
allosouris UTSW 19 3378472 missense probably damaging 1.00
Tyrannosouris UTSW 19 3362156 missense probably damaging 1.00
R0029:Cpt1a UTSW 19 3381674 missense probably benign 0.04
R0029:Cpt1a UTSW 19 3381674 missense probably benign 0.04
R0305:Cpt1a UTSW 19 3378455 missense probably benign
R0963:Cpt1a UTSW 19 3381634 missense probably damaging 1.00
R1511:Cpt1a UTSW 19 3365788 splice site probably benign
R2102:Cpt1a UTSW 19 3371585 missense probably benign 0.25
R3034:Cpt1a UTSW 19 3378390 missense probably damaging 1.00
R3153:Cpt1a UTSW 19 3356430 missense probably damaging 0.99
R5195:Cpt1a UTSW 19 3383800 missense possibly damaging 0.88
R5391:Cpt1a UTSW 19 3349260 missense probably damaging 0.98
R5964:Cpt1a UTSW 19 3365760 missense possibly damaging 0.80
R6031:Cpt1a UTSW 19 3371556 splice site probably null
R6031:Cpt1a UTSW 19 3371556 splice site probably null
R6246:Cpt1a UTSW 19 3376550 missense probably damaging 0.99
R6339:Cpt1a UTSW 19 3362152 missense probably benign 0.27
R6535:Cpt1a UTSW 19 3365788 splice site probably null
R6621:Cpt1a UTSW 19 3378472 missense probably damaging 1.00
R6892:Cpt1a UTSW 19 3371660 missense probably benign 0.00
R7142:Cpt1a UTSW 19 3375100 missense probably benign 0.00
R7385:Cpt1a UTSW 19 3380155 missense probably damaging 0.99
R7908:Cpt1a UTSW 19 3362202 missense probably benign 0.26
R8098:Cpt1a UTSW 19 3370849 missense probably benign
R8362:Cpt1a UTSW 19 3370744 nonsense probably null
R8444:Cpt1a UTSW 19 3381981 missense probably benign
X0019:Cpt1a UTSW 19 3366348 missense probably benign 0.01
Z1177:Cpt1a UTSW 19 3366370 missense probably damaging 1.00
Z1177:Cpt1a UTSW 19 3370727 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGACTGTCTTGTCCGGTCTATC -3'
(R):5'- CTCTCAGGGGAAAGTATGGC -3'

Sequencing Primer
(F):5'- CGGTCTATCTGCCTATGTAAAAGCAG -3'
(R):5'- AAAGTATGGCTGCCCTCAG -3'
Posted On2018-05-24