Incidental Mutation 'R6428:Hdlbp'
ID518385
Institutional Source Beutler Lab
Gene Symbol Hdlbp
Ensembl Gene ENSMUSG00000034088
Gene Namehigh density lipoprotein (HDL) binding protein
Synonyms1110005P14Rik, D1Ertd101e
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.917) question?
Stock #R6428 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location93405940-93478815 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 93431445 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 175 (D175G)
Ref Sequence ENSEMBL: ENSMUSP00000139671 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042498] [ENSMUST00000170883] [ENSMUST00000186164] [ENSMUST00000188988] [ENSMUST00000190321]
Predicted Effect probably benign
Transcript: ENSMUST00000042498
AA Change: D175G

PolyPhen 2 Score 0.037 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000043047
Gene: ENSMUSG00000034088
AA Change: D175G

DomainStartEndE-ValueType
KH 149 217 1.97e-15 SMART
KH 221 289 1.8e-9 SMART
KH 294 362 1.73e-11 SMART
KH 363 429 2.66e-12 SMART
KH 434 502 9.18e-16 SMART
KH 506 575 7.52e-12 SMART
KH 580 648 7.68e-18 SMART
KH 652 721 3.24e-16 SMART
KH 726 795 1.33e-12 SMART
KH 799 868 2.48e-12 SMART
KH 872 972 3.03e-16 SMART
KH 973 1039 4.56e-11 SMART
KH 1051 1122 3.67e-15 SMART
KH 1126 1195 3.37e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000170883
AA Change: D175G

PolyPhen 2 Score 0.037 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000127903
Gene: ENSMUSG00000034088
AA Change: D175G

DomainStartEndE-ValueType
KH 149 217 1.97e-15 SMART
KH 221 289 1.8e-9 SMART
KH 294 362 1.73e-11 SMART
KH 363 429 2.66e-12 SMART
KH 434 502 9.18e-16 SMART
KH 506 575 7.52e-12 SMART
KH 580 648 7.68e-18 SMART
KH 652 721 3.24e-16 SMART
KH 726 795 1.33e-12 SMART
KH 799 868 2.48e-12 SMART
KH 872 972 3.03e-16 SMART
KH 973 1039 4.56e-11 SMART
KH 1051 1122 3.67e-15 SMART
KH 1126 1195 3.37e-14 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000186164
AA Change: D175G

PolyPhen 2 Score 0.912 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000139671
Gene: ENSMUSG00000034088
AA Change: D175G

DomainStartEndE-ValueType
KH 149 217 1.2e-17 SMART
KH 221 289 1.1e-11 SMART
KH 294 360 1.6e-14 SMART
KH 365 433 5.7e-18 SMART
KH 437 506 4.6e-14 SMART
KH 511 579 4.7e-20 SMART
KH 583 652 2e-18 SMART
KH 657 726 7.9e-15 SMART
KH 730 799 1.5e-14 SMART
KH 803 903 1.8e-18 SMART
KH 904 970 2.8e-13 SMART
KH 982 1053 2.2e-17 SMART
KH 1057 1126 2e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000188988
AA Change: D175G

PolyPhen 2 Score 0.317 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000140946
Gene: ENSMUSG00000034088
AA Change: D175G

DomainStartEndE-ValueType
Blast:KH 74 148 2e-28 BLAST
Pfam:KH_1 152 177 2e-4 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189951
Predicted Effect probably benign
Transcript: ENSMUST00000190321
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene binds high density lipoprotein (HDL) and may function to regulate excess cholesterol levels in cells. The encoded protein also binds RNA and can induce heterochromatin formation. [provided by RefSeq, Mar 2016]
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abat C T 16: 8,602,436 probably benign Het
Cts6 T G 13: 61,196,423 N272H probably damaging Het
Daam2 C T 17: 49,469,376 E828K probably damaging Het
Dhx9 C T 1: 153,456,578 probably benign Het
Glb1l3 T C 9: 26,859,452 N106S probably damaging Het
Gm1141 CATCTTTACCATCATGTCAAGTATCTTTACCATCATGTCAAGTATCTTTACC CATCTTTACCATCATGTCAAGTATCTTTACC X: 71,939,520 probably benign Homo
Hectd4 A G 5: 121,350,445 K3600E possibly damaging Het
Hspa13 A T 16: 75,757,986 L404Q probably damaging Het
Iws1 A G 18: 32,086,290 D475G probably damaging Het
Klhdc10 T C 6: 30,439,856 S13P probably damaging Het
Lepr C T 4: 101,780,098 T728I probably damaging Het
Ncapd3 A G 9: 27,052,664 probably null Het
Phb2 A G 6: 124,715,991 D276G probably benign Het
Prrc2b A G 2: 32,226,496 probably null Het
Rasgrf2 T C 13: 91,987,981 K604R probably damaging Het
Rp1l1 T A 14: 64,032,389 M1808K possibly damaging Het
Setd3 T C 12: 108,113,338 D302G probably damaging Het
Slc38a10 T A 11: 120,105,472 Q933L probably benign Het
Slco1a1 A G 6: 141,925,690 L250S probably damaging Het
Vmn2r106 C T 17: 20,268,463 C558Y probably damaging Het
Vmn2r26 A G 6: 124,026,080 I150V probably benign Het
Zfp318 C T 17: 46,399,336 R662C probably damaging Het
Other mutations in Hdlbp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01025:Hdlbp APN 1 93430169 missense probably benign 0.00
IGL01321:Hdlbp APN 1 93423802 missense probably damaging 1.00
IGL01387:Hdlbp APN 1 93413588 missense possibly damaging 0.91
IGL01443:Hdlbp APN 1 93431074 missense probably damaging 0.99
IGL01467:Hdlbp APN 1 93417698 splice site probably benign
IGL02223:Hdlbp APN 1 93412449 missense probably damaging 1.00
IGL02274:Hdlbp APN 1 93408507 splice site probably null
IGL02452:Hdlbp APN 1 93417511 missense probably damaging 1.00
IGL03079:Hdlbp APN 1 93413940 splice site probably benign
IGL03169:Hdlbp APN 1 93416587 missense possibly damaging 0.92
IGL03229:Hdlbp APN 1 93430187 missense probably benign 0.00
R0119:Hdlbp UTSW 1 93421337 splice site probably benign
R0432:Hdlbp UTSW 1 93425332 missense probably damaging 1.00
R0508:Hdlbp UTSW 1 93414811 critical splice donor site probably null
R0530:Hdlbp UTSW 1 93430317 unclassified probably benign
R1276:Hdlbp UTSW 1 93421101 missense probably benign 0.12
R1302:Hdlbp UTSW 1 93423385 splice site probably null
R1331:Hdlbp UTSW 1 93421131 missense probably damaging 1.00
R1537:Hdlbp UTSW 1 93417374 missense probably benign 0.01
R1623:Hdlbp UTSW 1 93423869 missense probably damaging 1.00
R1695:Hdlbp UTSW 1 93437200 missense probably damaging 1.00
R1897:Hdlbp UTSW 1 93422285 intron probably benign
R1900:Hdlbp UTSW 1 93422237 intron probably benign
R1984:Hdlbp UTSW 1 93431118 missense probably damaging 0.98
R1985:Hdlbp UTSW 1 93431118 missense probably damaging 0.98
R2066:Hdlbp UTSW 1 93421880 intron probably benign
R2277:Hdlbp UTSW 1 93408178 nonsense probably null
R2349:Hdlbp UTSW 1 93422234 intron probably benign
R3434:Hdlbp UTSW 1 93428161 missense probably benign 0.04
R3978:Hdlbp UTSW 1 93421351 missense probably damaging 1.00
R4645:Hdlbp UTSW 1 93422120 intron probably benign
R5196:Hdlbp UTSW 1 93420193 missense probably damaging 1.00
R5760:Hdlbp UTSW 1 93440777 intron probably benign
R6327:Hdlbp UTSW 1 93429464 missense possibly damaging 0.87
R6420:Hdlbp UTSW 1 93431004 missense probably damaging 1.00
R6468:Hdlbp UTSW 1 93417667 missense possibly damaging 0.48
R6488:Hdlbp UTSW 1 93428224 missense probably damaging 1.00
R6592:Hdlbp UTSW 1 93412361 critical splice donor site probably null
R6920:Hdlbp UTSW 1 93412361 critical splice donor site probably null
R7156:Hdlbp UTSW 1 93413915 missense probably damaging 1.00
R7391:Hdlbp UTSW 1 93431061 missense possibly damaging 0.93
R7457:Hdlbp UTSW 1 93428222 missense probably benign 0.04
R7498:Hdlbp UTSW 1 93413615 missense probably benign 0.00
R7554:Hdlbp UTSW 1 93437309 missense probably damaging 0.96
R7593:Hdlbp UTSW 1 93430283 missense probably benign 0.01
R7672:Hdlbp UTSW 1 93437099 missense possibly damaging 0.90
R7801:Hdlbp UTSW 1 93430307 splice site probably null
R7904:Hdlbp UTSW 1 93423370 missense probably damaging 1.00
R7987:Hdlbp UTSW 1 93423370 missense probably damaging 1.00
R8062:Hdlbp UTSW 1 93438342 missense probably benign 0.10
R8113:Hdlbp UTSW 1 93417195 missense probably damaging 0.98
RF020:Hdlbp UTSW 1 93440734 missense probably benign
Z1088:Hdlbp UTSW 1 93431354 start gained probably benign
Predicted Primers PCR Primer
(F):5'- ATTGGCAGTCAAGGTCTCCC -3'
(R):5'- GAGCTCTCTCATGCTTATAATGGG -3'

Sequencing Primer
(F):5'- ACACACGCTGCTTCAGTG -3'
(R):5'- TGGTCTCTCCTGTTACAGG -3'
Posted On2018-05-24