Incidental Mutation 'R6428:Phb2'
ID518392
Institutional Source Beutler Lab
Gene Symbol Phb2
Ensembl Gene ENSMUSG00000004264
Gene Nameprohibitin 2
SynonymsBcap37, Bap37, repressor of estrogen receptor activity, REA
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6428 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location124712336-124716950 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 124715991 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 276 (D276G)
Ref Sequence ENSEMBL: ENSMUSP00000004375 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004375] [ENSMUST00000004377] [ENSMUST00000004379] [ENSMUST00000112484] [ENSMUST00000147974] [ENSMUST00000171549] [ENSMUST00000203238]
Predicted Effect probably benign
Transcript: ENSMUST00000004375
AA Change: D276G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000004375
Gene: ENSMUSG00000004264
AA Change: D276G

DomainStartEndE-ValueType
low complexity region 18 33 N/A INTRINSIC
PHB 39 201 1.01e-46 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000004377
SMART Domains Protein: ENSMUSP00000004377
Gene: ENSMUSG00000004266

DomainStartEndE-ValueType
SH2 4 87 1.43e-28 SMART
SH2 110 202 1.45e-29 SMART
PTPc 245 519 7.51e-131 SMART
low complexity region 571 581 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000004379
SMART Domains Protein: ENSMUSP00000004379
Gene: ENSMUSG00000004268

DomainStartEndE-ValueType
Pfam:EMG1 45 238 2.9e-87 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083528
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083540
Predicted Effect probably benign
Transcript: ENSMUST00000112484
SMART Domains Protein: ENSMUSP00000108103
Gene: ENSMUSG00000004266

DomainStartEndE-ValueType
SH2 2 85 4.05e-28 SMART
SH2 108 200 1.45e-29 SMART
PTPc 243 517 7.51e-131 SMART
low complexity region 569 579 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124779
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129422
Predicted Effect unknown
Transcript: ENSMUST00000130279
AA Change: D133G
SMART Domains Protein: ENSMUSP00000121535
Gene: ENSMUSG00000004264
AA Change: D133G

DomainStartEndE-ValueType
Blast:PHB 2 82 5e-45 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141251
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142187
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143000
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143765
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145447
Predicted Effect probably benign
Transcript: ENSMUST00000147974
SMART Domains Protein: ENSMUSP00000119316
Gene: ENSMUSG00000004264

DomainStartEndE-ValueType
PHB 1 103 3.22e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150847
Predicted Effect noncoding transcript
Transcript: ENSMUST00000158210
Predicted Effect probably benign
Transcript: ENSMUST00000171549
SMART Domains Protein: ENSMUSP00000129124
Gene: ENSMUSG00000004266

DomainStartEndE-ValueType
SH2 4 87 1.43e-28 SMART
SH2 110 202 1.45e-29 SMART
PTPc 245 519 7.51e-131 SMART
low complexity region 571 581 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173315
SMART Domains Protein: ENSMUSP00000134274
Gene: ENSMUSG00000004266

DomainStartEndE-ValueType
SCOP:d1eeoa_ 2 38 1e-3 SMART
PDB:3PS5|A 2 91 2e-41 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189387
Predicted Effect probably benign
Transcript: ENSMUST00000203238
SMART Domains Protein: ENSMUSP00000144730
Gene: ENSMUSG00000004268

DomainStartEndE-ValueType
Pfam:EMG1 55 122 1e-33 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous mutant embryos die before E9. Heterozygous females exhibit a greater gain in body weight from 9-26 weeks of age and reduced litter sizes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abat C T 16: 8,602,436 probably benign Het
Cts6 T G 13: 61,196,423 N272H probably damaging Het
Daam2 C T 17: 49,469,376 E828K probably damaging Het
Dhx9 C T 1: 153,456,578 probably benign Het
Glb1l3 T C 9: 26,859,452 N106S probably damaging Het
Gm1141 CATCTTTACCATCATGTCAAGTATCTTTACCATCATGTCAAGTATCTTTACC CATCTTTACCATCATGTCAAGTATCTTTACC X: 71,939,520 probably benign Homo
Hdlbp T C 1: 93,431,445 D175G possibly damaging Het
Hectd4 A G 5: 121,350,445 K3600E possibly damaging Het
Hspa13 A T 16: 75,757,986 L404Q probably damaging Het
Iws1 A G 18: 32,086,290 D475G probably damaging Het
Klhdc10 T C 6: 30,439,856 S13P probably damaging Het
Lepr C T 4: 101,780,098 T728I probably damaging Het
Ncapd3 A G 9: 27,052,664 probably null Het
Prrc2b A G 2: 32,226,496 probably null Het
Rasgrf2 T C 13: 91,987,981 K604R probably damaging Het
Rp1l1 T A 14: 64,032,389 M1808K possibly damaging Het
Setd3 T C 12: 108,113,338 D302G probably damaging Het
Slc38a10 T A 11: 120,105,472 Q933L probably benign Het
Slco1a1 A G 6: 141,925,690 L250S probably damaging Het
Vmn2r106 C T 17: 20,268,463 C558Y probably damaging Het
Vmn2r26 A G 6: 124,026,080 I150V probably benign Het
Zfp318 C T 17: 46,399,336 R662C probably damaging Het
Other mutations in Phb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01707:Phb2 APN 6 124714035 missense probably benign
R3872:Phb2 UTSW 6 124716431 critical splice donor site probably null
R4686:Phb2 UTSW 6 124713142 critical splice donor site probably null
R4730:Phb2 UTSW 6 124713123 missense probably damaging 1.00
R5503:Phb2 UTSW 6 124713022 unclassified probably benign
R5930:Phb2 UTSW 6 124715649 missense probably damaging 1.00
R7780:Phb2 UTSW 6 124716032 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GCTATGACACTAAGCCTTCTTGC -3'
(R):5'- CCCATAAGACATCCTGCTTTGC -3'

Sequencing Primer
(F):5'- AAGCCTTCTTGCATCGGG -3'
(R):5'- GACATCCTGCTTTGCTTTATAAAGTC -3'
Posted On2018-05-24