Incidental Mutation 'R6428:Slco1a1'
ID518393
Institutional Source Beutler Lab
Gene Symbol Slco1a1
Ensembl Gene ENSMUSG00000041698
Gene Namesolute carrier organic anion transporter family, member 1a1
SynonymsOatp1, Slc21a1, Oatp1a1
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.341) question?
Stock #R6428 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location141907282-141946962 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 141925690 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Serine at position 250 (L250S)
Ref Sequence ENSEMBL: ENSMUSP00000132386 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042119] [ENSMUST00000168119]
Predicted Effect probably damaging
Transcript: ENSMUST00000042119
AA Change: L250S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000037022
Gene: ENSMUSG00000041698
AA Change: L250S

DomainStartEndE-ValueType
Pfam:OATP 21 597 6e-168 PFAM
Pfam:MFS_1 22 410 4.7e-28 PFAM
Pfam:Kazal_2 445 486 1.2e-10 PFAM
transmembrane domain 600 622 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000168119
AA Change: L250S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000132386
Gene: ENSMUSG00000041698
AA Change: L250S

DomainStartEndE-ValueType
Pfam:OATP 21 597 1.6e-168 PFAM
Pfam:MFS_1 22 410 1e-27 PFAM
Pfam:Kazal_2 445 486 4.6e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171651
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired organic anion transporter activity and urinary metabolomic profiles. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abat C T 16: 8,602,436 probably benign Het
Cts6 T G 13: 61,196,423 N272H probably damaging Het
Daam2 C T 17: 49,469,376 E828K probably damaging Het
Dhx9 C T 1: 153,456,578 probably benign Het
Glb1l3 T C 9: 26,859,452 N106S probably damaging Het
Gm1141 CATCTTTACCATCATGTCAAGTATCTTTACCATCATGTCAAGTATCTTTACC CATCTTTACCATCATGTCAAGTATCTTTACC X: 71,939,520 probably benign Homo
Hdlbp T C 1: 93,431,445 D175G possibly damaging Het
Hectd4 A G 5: 121,350,445 K3600E possibly damaging Het
Hspa13 A T 16: 75,757,986 L404Q probably damaging Het
Iws1 A G 18: 32,086,290 D475G probably damaging Het
Klhdc10 T C 6: 30,439,856 S13P probably damaging Het
Lepr C T 4: 101,780,098 T728I probably damaging Het
Ncapd3 A G 9: 27,052,664 probably null Het
Phb2 A G 6: 124,715,991 D276G probably benign Het
Prrc2b A G 2: 32,226,496 probably null Het
Rasgrf2 T C 13: 91,987,981 K604R probably damaging Het
Rp1l1 T A 14: 64,032,389 M1808K possibly damaging Het
Setd3 T C 12: 108,113,338 D302G probably damaging Het
Slc38a10 T A 11: 120,105,472 Q933L probably benign Het
Vmn2r106 C T 17: 20,268,463 C558Y probably damaging Het
Vmn2r26 A G 6: 124,026,080 I150V probably benign Het
Zfp318 C T 17: 46,399,336 R662C probably damaging Het
Other mutations in Slco1a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00327:Slco1a1 APN 6 141909125 missense probably damaging 0.98
IGL00942:Slco1a1 APN 6 141946628 missense probably benign 0.00
IGL01301:Slco1a1 APN 6 141932530 splice site probably benign
IGL01306:Slco1a1 APN 6 141946587 nonsense probably null
IGL01774:Slco1a1 APN 6 141925613 nonsense probably null
IGL02097:Slco1a1 APN 6 141940039 missense possibly damaging 0.94
IGL02183:Slco1a1 APN 6 141921943 splice site probably benign
IGL02376:Slco1a1 APN 6 141924334 critical splice donor site probably null
IGL02550:Slco1a1 APN 6 141943465 missense probably benign 0.24
IGL02559:Slco1a1 APN 6 141921788 missense probably benign 0.01
IGL02825:Slco1a1 APN 6 141918617 missense probably damaging 1.00
IGL03352:Slco1a1 APN 6 141911885 missense probably benign 0.00
ANU23:Slco1a1 UTSW 6 141946587 nonsense probably null
R0041:Slco1a1 UTSW 6 141918459 splice site probably benign
R0153:Slco1a1 UTSW 6 141910701 splice site probably benign
R0610:Slco1a1 UTSW 6 141918461 critical splice donor site probably null
R0646:Slco1a1 UTSW 6 141925754 splice site probably benign
R0828:Slco1a1 UTSW 6 141921839 missense possibly damaging 0.89
R1674:Slco1a1 UTSW 6 141935935 missense probably damaging 0.99
R1848:Slco1a1 UTSW 6 141923111 missense probably benign 0.29
R3834:Slco1a1 UTSW 6 141943437 missense possibly damaging 0.94
R3953:Slco1a1 UTSW 6 141923107 missense probably damaging 1.00
R3974:Slco1a1 UTSW 6 141909093 missense probably benign 0.01
R4081:Slco1a1 UTSW 6 141935962 missense probably damaging 0.99
R4729:Slco1a1 UTSW 6 141908969 missense probably benign 0.00
R4752:Slco1a1 UTSW 6 141946614 missense possibly damaging 0.80
R4806:Slco1a1 UTSW 6 141909009 missense possibly damaging 0.76
R4812:Slco1a1 UTSW 6 141918593 missense probably damaging 1.00
R4963:Slco1a1 UTSW 6 141923099 missense probably benign 0.26
R5641:Slco1a1 UTSW 6 141939969 missense probably damaging 1.00
R6044:Slco1a1 UTSW 6 141940017 missense probably benign 0.01
R6211:Slco1a1 UTSW 6 141909049 missense probably benign 0.20
R6225:Slco1a1 UTSW 6 141924489 missense possibly damaging 0.70
R6328:Slco1a1 UTSW 6 141932450 missense probably damaging 1.00
R6787:Slco1a1 UTSW 6 141936487 missense probably benign 0.00
R7182:Slco1a1 UTSW 6 141911839 missense probably damaging 1.00
R7305:Slco1a1 UTSW 6 141924497 missense probably damaging 1.00
R7328:Slco1a1 UTSW 6 141936408 missense possibly damaging 0.94
R7723:Slco1a1 UTSW 6 141909069 missense probably damaging 0.97
R7784:Slco1a1 UTSW 6 141943388 missense probably damaging 0.99
R8348:Slco1a1 UTSW 6 141940061 missense possibly damaging 0.79
R8448:Slco1a1 UTSW 6 141940061 missense possibly damaging 0.79
R8856:Slco1a1 UTSW 6 141911898 missense probably damaging 1.00
Z1177:Slco1a1 UTSW 6 141940018 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CAGCACAAGTGACAGATGCC -3'
(R):5'- TTCAACTTCACAGAATGAGTCAACCTC -3'

Sequencing Primer
(F):5'- AGTGACAGATGCCCACTAAAC -3'
(R):5'- TAAAGGTCTGAATTACCCCCGTGAG -3'
Posted On2018-05-24