Incidental Mutation 'R6428:Setd3'
ID518397
Institutional Source Beutler Lab
Gene Symbol Setd3
Ensembl Gene ENSMUSG00000056770
Gene NameSET domain containing 3
Synonyms2610305M23Rik, 2610102I01Rik, D12Ertd771e
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6428 (G1)
Quality Score199.009
Status Not validated
Chromosome12
Chromosomal Location108106431-108179314 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 108113338 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 302 (D302G)
Ref Sequence ENSEMBL: ENSMUSP00000066413 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071095] [ENSMUST00000109879] [ENSMUST00000132682] [ENSMUST00000147466]
Predicted Effect probably damaging
Transcript: ENSMUST00000071095
AA Change: D302G

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000066413
Gene: ENSMUSG00000056770
AA Change: D302G

DomainStartEndE-ValueType
Pfam:SET 105 314 2.1e-12 PFAM
Pfam:Rubis-subs-bind 345 475 3.7e-31 PFAM
low complexity region 565 577 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109879
SMART Domains Protein: ENSMUSP00000105505
Gene: ENSMUSG00000056770

DomainStartEndE-ValueType
Pfam:SET 105 287 6.5e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125210
Predicted Effect probably benign
Transcript: ENSMUST00000132682
SMART Domains Protein: ENSMUSP00000123159
Gene: ENSMUSG00000056770

DomainStartEndE-ValueType
PDB:3SMT|A 2 58 3e-30 PDB
SCOP:d1epua_ 50 79 6e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000147466
SMART Domains Protein: ENSMUSP00000121406
Gene: ENSMUSG00000056770

DomainStartEndE-ValueType
PDB:3SMT|A 2 58 3e-30 PDB
SCOP:d1epua_ 50 79 6e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148119
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169951
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abat C T 16: 8,602,436 probably benign Het
Cts6 T G 13: 61,196,423 N272H probably damaging Het
Daam2 C T 17: 49,469,376 E828K probably damaging Het
Dhx9 C T 1: 153,456,578 probably benign Het
Glb1l3 T C 9: 26,859,452 N106S probably damaging Het
Gm1141 CATCTTTACCATCATGTCAAGTATCTTTACCATCATGTCAAGTATCTTTACC CATCTTTACCATCATGTCAAGTATCTTTACC X: 71,939,520 probably benign Homo
Hdlbp T C 1: 93,431,445 D175G possibly damaging Het
Hectd4 A G 5: 121,350,445 K3600E possibly damaging Het
Hspa13 A T 16: 75,757,986 L404Q probably damaging Het
Iws1 A G 18: 32,086,290 D475G probably damaging Het
Klhdc10 T C 6: 30,439,856 S13P probably damaging Het
Lepr C T 4: 101,780,098 T728I probably damaging Het
Ncapd3 A G 9: 27,052,664 probably null Het
Phb2 A G 6: 124,715,991 D276G probably benign Het
Prrc2b A G 2: 32,226,496 probably null Het
Rasgrf2 T C 13: 91,987,981 K604R probably damaging Het
Rp1l1 T A 14: 64,032,389 M1808K possibly damaging Het
Slc38a10 T A 11: 120,105,472 Q933L probably benign Het
Slco1a1 A G 6: 141,925,690 L250S probably damaging Het
Vmn2r106 C T 17: 20,268,463 C558Y probably damaging Het
Vmn2r26 A G 6: 124,026,080 I150V probably benign Het
Zfp318 C T 17: 46,399,336 R662C probably damaging Het
Other mutations in Setd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00971:Setd3 APN 12 108160237 missense probably damaging 1.00
IGL01365:Setd3 APN 12 108157906 missense probably damaging 1.00
IGL02031:Setd3 APN 12 108163030 missense probably damaging 1.00
IGL02826:Setd3 APN 12 108112124 unclassified probably benign
IGL02878:Setd3 APN 12 108108555 critical splice donor site probably null
IGL03039:Setd3 APN 12 108162970 splice site probably null
R0332:Setd3 UTSW 12 108107579 missense probably benign
R1644:Setd3 UTSW 12 108113344 missense possibly damaging 0.88
R1776:Setd3 UTSW 12 108165161 missense probably damaging 1.00
R2018:Setd3 UTSW 12 108118254 missense probably damaging 1.00
R2025:Setd3 UTSW 12 108160267 missense probably damaging 1.00
R2041:Setd3 UTSW 12 108113392 missense possibly damaging 0.84
R2058:Setd3 UTSW 12 108107341 missense probably benign 0.03
R2206:Setd3 UTSW 12 108107285 missense probably benign 0.11
R2207:Setd3 UTSW 12 108107285 missense probably benign 0.11
R3973:Setd3 UTSW 12 108165158 missense possibly damaging 0.93
R3976:Setd3 UTSW 12 108165158 missense possibly damaging 0.93
R3978:Setd3 UTSW 12 108157942 missense possibly damaging 0.63
R4684:Setd3 UTSW 12 108108690 missense probably benign 0.05
R4965:Setd3 UTSW 12 108113371 missense probably benign 0.29
R5691:Setd3 UTSW 12 108160285 missense probably benign 0.19
R5990:Setd3 UTSW 12 108160335 missense probably benign
R6198:Setd3 UTSW 12 108165168 missense possibly damaging 0.66
R6241:Setd3 UTSW 12 108157855 missense probably benign 0.24
R7652:Setd3 UTSW 12 108112289 missense probably damaging 1.00
R7913:Setd3 UTSW 12 108107665 missense probably benign 0.37
R7994:Setd3 UTSW 12 108107665 missense probably benign 0.37
R8221:Setd3 UTSW 12 108107353 missense possibly damaging 0.91
X0052:Setd3 UTSW 12 108107665 missense probably benign 0.37
Predicted Primers PCR Primer
(F):5'- GGTTCAGTTGTGCAAACAGC -3'
(R):5'- GACCCAGAAATGATGCACATTATC -3'

Sequencing Primer
(F):5'- CAGTTGTGCAAACAGCTACATTG -3'
(R):5'- CAGATTTGCAGTTTCCTGTACAG -3'
Posted On2018-05-24