Incidental Mutation 'R6428:Cts6'
ID518398
Institutional Source Beutler Lab
Gene Symbol Cts6
Ensembl Gene ENSMUSG00000021441
Gene Namecathepsin 6
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6428 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location61195132-61203410 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 61196423 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Histidine at position 272 (N272H)
Ref Sequence ENSEMBL: ENSMUSP00000021890 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021890]
Predicted Effect probably damaging
Transcript: ENSMUST00000021890
AA Change: N272H

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000021890
Gene: ENSMUSG00000021441
AA Change: N272H

DomainStartEndE-ValueType
Inhibitor_I29 29 88 3.17e-22 SMART
Pept_C1 115 333 9.61e-111 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abat C T 16: 8,602,436 probably benign Het
Daam2 C T 17: 49,469,376 E828K probably damaging Het
Dhx9 C T 1: 153,456,578 probably benign Het
Glb1l3 T C 9: 26,859,452 N106S probably damaging Het
Gm1141 CATCTTTACCATCATGTCAAGTATCTTTACCATCATGTCAAGTATCTTTACC CATCTTTACCATCATGTCAAGTATCTTTACC X: 71,939,520 probably benign Homo
Hdlbp T C 1: 93,431,445 D175G possibly damaging Het
Hectd4 A G 5: 121,350,445 K3600E possibly damaging Het
Hspa13 A T 16: 75,757,986 L404Q probably damaging Het
Iws1 A G 18: 32,086,290 D475G probably damaging Het
Klhdc10 T C 6: 30,439,856 S13P probably damaging Het
Lepr C T 4: 101,780,098 T728I probably damaging Het
Ncapd3 A G 9: 27,052,664 probably null Het
Phb2 A G 6: 124,715,991 D276G probably benign Het
Prrc2b A G 2: 32,226,496 probably null Het
Rasgrf2 T C 13: 91,987,981 K604R probably damaging Het
Rp1l1 T A 14: 64,032,389 M1808K possibly damaging Het
Setd3 T C 12: 108,113,338 D302G probably damaging Het
Slc38a10 T A 11: 120,105,472 Q933L probably benign Het
Slco1a1 A G 6: 141,925,690 L250S probably damaging Het
Vmn2r106 C T 17: 20,268,463 C558Y probably damaging Het
Vmn2r26 A G 6: 124,026,080 I150V probably benign Het
Zfp318 C T 17: 46,399,336 R662C probably damaging Het
Other mutations in Cts6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00770:Cts6 APN 13 61198339 splice site probably benign
IGL00774:Cts6 APN 13 61198339 splice site probably benign
IGL02237:Cts6 APN 13 61197499 missense probably benign 0.01
IGL03071:Cts6 APN 13 61202250 missense probably damaging 0.97
IGL03224:Cts6 APN 13 61201733 missense probably damaging 1.00
IGL03282:Cts6 APN 13 61196447 missense possibly damaging 0.56
R0086:Cts6 UTSW 13 61196457 splice site probably benign
R0201:Cts6 UTSW 13 61201499 nonsense probably null
R0238:Cts6 UTSW 13 61201819 missense probably damaging 1.00
R0238:Cts6 UTSW 13 61201819 missense probably damaging 1.00
R0401:Cts6 UTSW 13 61198339 splice site probably benign
R0676:Cts6 UTSW 13 61197484 splice site probably benign
R1471:Cts6 UTSW 13 61196380 missense probably benign 0.00
R1594:Cts6 UTSW 13 61198367 missense probably damaging 1.00
R1864:Cts6 UTSW 13 61201579 missense probably benign 0.26
R1865:Cts6 UTSW 13 61201579 missense probably benign 0.26
R1902:Cts6 UTSW 13 61201515 nonsense probably null
R2097:Cts6 UTSW 13 61195445 missense probably damaging 1.00
R2235:Cts6 UTSW 13 61195433 missense probably damaging 1.00
R2829:Cts6 UTSW 13 61201497 missense probably benign 0.01
R2910:Cts6 UTSW 13 61196401 missense probably damaging 1.00
R3757:Cts6 UTSW 13 61202158 nonsense probably null
R4460:Cts6 UTSW 13 61195458 missense probably benign 0.25
R4553:Cts6 UTSW 13 61197593 missense probably damaging 1.00
R4623:Cts6 UTSW 13 61202160 missense possibly damaging 0.57
R4793:Cts6 UTSW 13 61201812 missense probably benign 0.00
R4809:Cts6 UTSW 13 61202181 missense probably damaging 1.00
R4849:Cts6 UTSW 13 61201601 missense probably null
R4866:Cts6 UTSW 13 61202276 critical splice acceptor site probably null
R5055:Cts6 UTSW 13 61196350 missense probably damaging 1.00
R5590:Cts6 UTSW 13 61201812 missense probably benign 0.00
R6236:Cts6 UTSW 13 61196378 nonsense probably null
R6501:Cts6 UTSW 13 61196335 missense probably damaging 1.00
R6508:Cts6 UTSW 13 61196407 missense probably damaging 1.00
R6643:Cts6 UTSW 13 61201793 missense probably damaging 0.96
R7397:Cts6 UTSW 13 61202200 missense possibly damaging 0.94
R8283:Cts6 UTSW 13 61201643 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AATTACTGACTGCAACGGGC -3'
(R):5'- AAGGTTCTAAGGACTCATCTCATG -3'

Sequencing Primer
(F):5'- GTCTCCTAGAAGGGCAGCCAATATTC -3'
(R):5'- GTTTTGTGAGGCTTTATACATGTTAG -3'
Posted On2018-05-24