Incidental Mutation 'R6428:Abat'
ID518401
Institutional Source Beutler Lab
Gene Symbol Abat
Ensembl Gene ENSMUSG00000057880
Gene Name4-aminobutyrate aminotransferase
SynonymsGABA-T, 9630038C02Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6428 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location8513429-8621568 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) C to T at 8602436 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000116686 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065987] [ENSMUST00000115838] [ENSMUST00000115839] [ENSMUST00000138987]
Predicted Effect probably benign
Transcript: ENSMUST00000065987
SMART Domains Protein: ENSMUSP00000063548
Gene: ENSMUSG00000057880

DomainStartEndE-ValueType
Pfam:Aminotran_3 65 496 1.7e-136 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000115838
AA Change: H200Y
SMART Domains Protein: ENSMUSP00000111504
Gene: ENSMUSG00000057880
AA Change: H200Y

DomainStartEndE-ValueType
Pfam:Aminotran_3 76 186 5e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115839
SMART Domains Protein: ENSMUSP00000111505
Gene: ENSMUSG00000057880

DomainStartEndE-ValueType
Pfam:Aminotran_3 76 323 3.2e-64 PFAM
Pfam:Aminotran_3 317 390 1.8e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000138987
SMART Domains Protein: ENSMUSP00000116686
Gene: ENSMUSG00000057880

DomainStartEndE-ValueType
Pfam:Aminotran_3 53 232 1.9e-32 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000144444
AA Change: H104Y
SMART Domains Protein: ENSMUSP00000121881
Gene: ENSMUSG00000057880
AA Change: H104Y

DomainStartEndE-ValueType
Pfam:Aminotran_3 3 93 1.3e-19 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.3%
Validation Efficiency
MGI Phenotype FUNCTION: The encoded gene product is responsible for catabolism of gamma-aminobutyric acid (GABA), a mostly inhibitory neurotransmitter in the central nervous system, into succinic semialdehyde. Deficiency of this encoded protein includes psychomotor retardation, hypotonia, hyperreflexia, lethargy, refractory seizures, and EEG abnormalities. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2010]
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Cts6 T G 13: 61,196,423 N272H probably damaging Het
Daam2 C T 17: 49,469,376 E828K probably damaging Het
Dhx9 C T 1: 153,456,578 probably benign Het
Glb1l3 T C 9: 26,859,452 N106S probably damaging Het
Gm1141 CATCTTTACCATCATGTCAAGTATCTTTACCATCATGTCAAGTATCTTTACC CATCTTTACCATCATGTCAAGTATCTTTACC X: 71,939,520 probably benign Homo
Hdlbp T C 1: 93,431,445 D175G possibly damaging Het
Hectd4 A G 5: 121,350,445 K3600E possibly damaging Het
Hspa13 A T 16: 75,757,986 L404Q probably damaging Het
Iws1 A G 18: 32,086,290 D475G probably damaging Het
Klhdc10 T C 6: 30,439,856 S13P probably damaging Het
Lepr C T 4: 101,780,098 T728I probably damaging Het
Ncapd3 A G 9: 27,052,664 probably null Het
Phb2 A G 6: 124,715,991 D276G probably benign Het
Prrc2b A G 2: 32,226,496 probably null Het
Rasgrf2 T C 13: 91,987,981 K604R probably damaging Het
Rp1l1 T A 14: 64,032,389 M1808K possibly damaging Het
Setd3 T C 12: 108,113,338 D302G probably damaging Het
Slc38a10 T A 11: 120,105,472 Q933L probably benign Het
Slco1a1 A G 6: 141,925,690 L250S probably damaging Het
Vmn2r106 C T 17: 20,268,463 C558Y probably damaging Het
Vmn2r26 A G 6: 124,026,080 I150V probably benign Het
Zfp318 C T 17: 46,399,336 R662C probably damaging Het
Other mutations in Abat
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01635:Abat APN 16 8614046 missense probably benign 0.04
IGL01642:Abat APN 16 8600919 missense possibly damaging 0.81
IGL02024:Abat APN 16 8611136 missense probably damaging 1.00
IGL02071:Abat APN 16 8582812 missense probably damaging 1.00
R2853:Abat UTSW 16 8600968 missense probably damaging 1.00
R4839:Abat UTSW 16 8583648 intron probably benign
R4895:Abat UTSW 16 8615962 missense probably benign 0.00
R5378:Abat UTSW 16 8578277 missense probably benign 0.00
R5804:Abat UTSW 16 8578236 nonsense probably null
R6012:Abat UTSW 16 8582827 missense probably damaging 1.00
R6113:Abat UTSW 16 8572900 missense probably benign 0.01
R6122:Abat UTSW 16 8605550 missense probably benign 0.01
R6190:Abat UTSW 16 8605608 missense probably damaging 1.00
R6328:Abat UTSW 16 8602436 intron probably benign
R6382:Abat UTSW 16 8600986 missense probably benign 0.11
R6426:Abat UTSW 16 8602436 intron probably benign
R6427:Abat UTSW 16 8602436 intron probably benign
R6738:Abat UTSW 16 8602436 intron probably benign
R7009:Abat UTSW 16 8602367 missense probably benign 0.05
R7019:Abat UTSW 16 8618531 nonsense probably null
R7310:Abat UTSW 16 8605593 missense probably null 0.01
R7499:Abat UTSW 16 8603754 critical splice donor site probably null
R8122:Abat UTSW 16 8615897 missense probably damaging 1.00
R8138:Abat UTSW 16 8600965 missense probably benign 0.05
Z1177:Abat UTSW 16 8603753 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AAGTACTCATCCTGGACCCCTC -3'
(R):5'- AGTCAGGGTTTGTTGAAATGGAAC -3'

Sequencing Primer
(F):5'- ATCCTGGACCCCTCTGCAG -3'
(R):5'- CTGATCAGGACTGCCTAGGTATAC -3'
Posted On2018-05-24