Incidental Mutation 'R6428:Hspa13'
ID518402
Institutional Source Beutler Lab
Gene Symbol Hspa13
Ensembl Gene ENSMUSG00000032932
Gene Nameheat shock protein 70 family, member 13
Synonyms1600002I10Rik, Stch, 60kDa, B230217N24Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.593) question?
Stock #R6428 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location75745431-75767104 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 75757986 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 404 (L404Q)
Ref Sequence ENSEMBL: ENSMUSP00000048817 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046283] [ENSMUST00000114244] [ENSMUST00000232633]
Predicted Effect probably damaging
Transcript: ENSMUST00000046283
AA Change: L404Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000048817
Gene: ENSMUSG00000032932
AA Change: L404Q

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:HSP70 33 347 3.4e-79 PFAM
Pfam:HSP70 349 460 5e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114244
SMART Domains Protein: ENSMUSP00000109882
Gene: ENSMUSG00000032932

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:HSP70 33 260 1.2e-67 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137806
Predicted Effect probably benign
Transcript: ENSMUST00000232633
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the heat shock protein 70 family and is found associated with microsomes. Members of this protein family play a role in the processing of cytosolic and secretory proteins, as well as in the removal of denatured or incorrectly-folded proteins. The encoded protein contains an ATPase domain and has been shown to associate with a ubiquitin-like protein. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abat C T 16: 8,602,436 probably benign Het
Cts6 T G 13: 61,196,423 N272H probably damaging Het
Daam2 C T 17: 49,469,376 E828K probably damaging Het
Dhx9 C T 1: 153,456,578 probably benign Het
Glb1l3 T C 9: 26,859,452 N106S probably damaging Het
Gm1141 CATCTTTACCATCATGTCAAGTATCTTTACCATCATGTCAAGTATCTTTACC CATCTTTACCATCATGTCAAGTATCTTTACC X: 71,939,520 probably benign Homo
Hdlbp T C 1: 93,431,445 D175G possibly damaging Het
Hectd4 A G 5: 121,350,445 K3600E possibly damaging Het
Iws1 A G 18: 32,086,290 D475G probably damaging Het
Klhdc10 T C 6: 30,439,856 S13P probably damaging Het
Lepr C T 4: 101,780,098 T728I probably damaging Het
Ncapd3 A G 9: 27,052,664 probably null Het
Phb2 A G 6: 124,715,991 D276G probably benign Het
Prrc2b A G 2: 32,226,496 probably null Het
Rasgrf2 T C 13: 91,987,981 K604R probably damaging Het
Rp1l1 T A 14: 64,032,389 M1808K possibly damaging Het
Setd3 T C 12: 108,113,338 D302G probably damaging Het
Slc38a10 T A 11: 120,105,472 Q933L probably benign Het
Slco1a1 A G 6: 141,925,690 L250S probably damaging Het
Vmn2r106 C T 17: 20,268,463 C558Y probably damaging Het
Vmn2r26 A G 6: 124,026,080 I150V probably benign Het
Zfp318 C T 17: 46,399,336 R662C probably damaging Het
Other mutations in Hspa13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00494:Hspa13 APN 16 75757992 missense possibly damaging 0.86
IGL03350:Hspa13 APN 16 75757829 missense probably damaging 1.00
R0329:Hspa13 UTSW 16 75765130 missense probably damaging 1.00
R1018:Hspa13 UTSW 16 75761276 missense possibly damaging 0.56
R1029:Hspa13 UTSW 16 75765237 missense probably damaging 1.00
R2043:Hspa13 UTSW 16 75758268 missense probably benign 0.01
R3404:Hspa13 UTSW 16 75758026 nonsense probably null
R3766:Hspa13 UTSW 16 75765086 missense probably benign 0.00
R4596:Hspa13 UTSW 16 75758226 missense probably benign 0.01
R4610:Hspa13 UTSW 16 75761302 missense probably benign 0.02
R4839:Hspa13 UTSW 16 75765281 missense probably damaging 1.00
R5621:Hspa13 UTSW 16 75766763 utr 5 prime probably benign
R5782:Hspa13 UTSW 16 75758097 missense probably damaging 1.00
R6597:Hspa13 UTSW 16 75765197 missense probably damaging 1.00
R6746:Hspa13 UTSW 16 75765037 missense possibly damaging 0.89
R6903:Hspa13 UTSW 16 75757984 missense probably damaging 1.00
Z1088:Hspa13 UTSW 16 75758185 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGTTACCAGCACTCCCTCAG -3'
(R):5'- ACCTGGCCTTTCTGAAAGC -3'

Sequencing Primer
(F):5'- AGCACTCCCTCAGTTCAGTTGAAG -3'
(R):5'- CCTGGCCTTTCTGAAAGCAAGAG -3'
Posted On2018-05-24