Incidental Mutation 'R6428:Vmn2r106'
ID518403
Institutional Source Beutler Lab
Gene Symbol Vmn2r106
Ensembl Gene ENSMUSG00000091656
Gene Namevomeronasal 2, receptor 106
SynonymsEG224576
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.137) question?
Stock #R6428 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location20267547-20285430 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 20268463 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tyrosine at position 558 (C558Y)
Ref Sequence ENSEMBL: ENSMUSP00000126534 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000167464]
Predicted Effect probably damaging
Transcript: ENSMUST00000167464
AA Change: C558Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126534
Gene: ENSMUSG00000091656
AA Change: C558Y

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:ANF_receptor 83 471 3.8e-37 PFAM
Pfam:NCD3G 514 567 5.7e-22 PFAM
Pfam:7tm_3 596 835 1.3e-49 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abat C T 16: 8,602,436 probably benign Het
Cts6 T G 13: 61,196,423 N272H probably damaging Het
Daam2 C T 17: 49,469,376 E828K probably damaging Het
Dhx9 C T 1: 153,456,578 probably benign Het
Glb1l3 T C 9: 26,859,452 N106S probably damaging Het
Gm1141 CATCTTTACCATCATGTCAAGTATCTTTACCATCATGTCAAGTATCTTTACC CATCTTTACCATCATGTCAAGTATCTTTACC X: 71,939,520 probably benign Homo
Hdlbp T C 1: 93,431,445 D175G possibly damaging Het
Hectd4 A G 5: 121,350,445 K3600E possibly damaging Het
Hspa13 A T 16: 75,757,986 L404Q probably damaging Het
Iws1 A G 18: 32,086,290 D475G probably damaging Het
Klhdc10 T C 6: 30,439,856 S13P probably damaging Het
Lepr C T 4: 101,780,098 T728I probably damaging Het
Ncapd3 A G 9: 27,052,664 probably null Het
Phb2 A G 6: 124,715,991 D276G probably benign Het
Prrc2b A G 2: 32,226,496 probably null Het
Rasgrf2 T C 13: 91,987,981 K604R probably damaging Het
Rp1l1 T A 14: 64,032,389 M1808K possibly damaging Het
Setd3 T C 12: 108,113,338 D302G probably damaging Het
Slc38a10 T A 11: 120,105,472 Q933L probably benign Het
Slco1a1 A G 6: 141,925,690 L250S probably damaging Het
Vmn2r26 A G 6: 124,026,080 I150V probably benign Het
Zfp318 C T 17: 46,399,336 R662C probably damaging Het
Other mutations in Vmn2r106
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00979:Vmn2r106 APN 17 20277575 missense possibly damaging 0.90
IGL01313:Vmn2r106 APN 17 20278389 missense probably damaging 0.99
IGL01419:Vmn2r106 APN 17 20279545 missense probably benign 0.06
IGL01574:Vmn2r106 APN 17 20268310 missense possibly damaging 0.94
IGL01796:Vmn2r106 APN 17 20268052 missense possibly damaging 0.79
IGL01893:Vmn2r106 APN 17 20277468 missense probably benign 0.06
IGL01895:Vmn2r106 APN 17 20278965 missense probably benign 0.02
IGL02378:Vmn2r106 APN 17 20277529 missense probably damaging 1.00
IGL02430:Vmn2r106 APN 17 20278896 missense probably benign 0.38
IGL02664:Vmn2r106 APN 17 20268082 missense possibly damaging 0.88
IGL03308:Vmn2r106 APN 17 20278523 nonsense probably null
IGL03384:Vmn2r106 APN 17 20268143 missense probably damaging 0.99
R0401:Vmn2r106 UTSW 17 20279019 missense possibly damaging 0.86
R0842:Vmn2r106 UTSW 17 20268203 missense probably damaging 1.00
R0964:Vmn2r106 UTSW 17 20267597 missense probably benign 0.00
R1235:Vmn2r106 UTSW 17 20279479 missense probably benign 0.00
R1709:Vmn2r106 UTSW 17 20279111 missense probably benign 0.12
R1712:Vmn2r106 UTSW 17 20278735 missense probably benign 0.01
R1770:Vmn2r106 UTSW 17 20268298 missense probably damaging 0.99
R2049:Vmn2r106 UTSW 17 20268304 missense possibly damaging 0.90
R2245:Vmn2r106 UTSW 17 20268161 missense probably benign 0.13
R2336:Vmn2r106 UTSW 17 20268208 missense probably benign 0.18
R2910:Vmn2r106 UTSW 17 20278684 missense probably damaging 1.00
R3025:Vmn2r106 UTSW 17 20278885 missense probably benign 0.00
R3944:Vmn2r106 UTSW 17 20267651 missense probably damaging 1.00
R4081:Vmn2r106 UTSW 17 20267556 nonsense probably null
R4153:Vmn2r106 UTSW 17 20267818 missense probably damaging 1.00
R4356:Vmn2r106 UTSW 17 20279648 missense probably benign 0.06
R4426:Vmn2r106 UTSW 17 20285379 missense probably benign 0.00
R4590:Vmn2r106 UTSW 17 20277466 missense probably damaging 0.99
R4661:Vmn2r106 UTSW 17 20267623 missense probably benign 0.10
R5106:Vmn2r106 UTSW 17 20279133 critical splice acceptor site probably null
R5341:Vmn2r106 UTSW 17 20277526 missense probably benign 0.00
R5509:Vmn2r106 UTSW 17 20278422 missense probably damaging 0.99
R5826:Vmn2r106 UTSW 17 20278871 missense probably benign
R5859:Vmn2r106 UTSW 17 20285321 missense possibly damaging 0.72
R5937:Vmn2r106 UTSW 17 20285405 nonsense probably null
R5972:Vmn2r106 UTSW 17 20278476 missense probably benign
R6056:Vmn2r106 UTSW 17 20267544 unclassified probably null
R6108:Vmn2r106 UTSW 17 20268376 missense probably benign 0.11
R6114:Vmn2r106 UTSW 17 20268376 missense probably benign 0.11
R6115:Vmn2r106 UTSW 17 20268376 missense probably benign 0.11
R6132:Vmn2r106 UTSW 17 20268404 missense probably benign
R6208:Vmn2r106 UTSW 17 20268329 missense probably damaging 0.99
R6217:Vmn2r106 UTSW 17 20268239 missense probably benign 0.10
R6289:Vmn2r106 UTSW 17 20268463 missense probably damaging 1.00
R6378:Vmn2r106 UTSW 17 20278405 missense probably benign 0.19
R6390:Vmn2r106 UTSW 17 20268463 missense probably damaging 1.00
R6391:Vmn2r106 UTSW 17 20268463 missense probably damaging 1.00
R6392:Vmn2r106 UTSW 17 20268463 missense probably damaging 1.00
R6405:Vmn2r106 UTSW 17 20279099 missense probably benign 0.22
R6427:Vmn2r106 UTSW 17 20268463 missense probably damaging 1.00
R6435:Vmn2r106 UTSW 17 20268463 missense probably damaging 1.00
R6436:Vmn2r106 UTSW 17 20268463 missense probably damaging 1.00
R6437:Vmn2r106 UTSW 17 20268463 missense probably damaging 1.00
R6511:Vmn2r106 UTSW 17 20268463 missense probably damaging 1.00
R6512:Vmn2r106 UTSW 17 20268463 missense probably damaging 1.00
R6587:Vmn2r106 UTSW 17 20268463 missense probably damaging 1.00
R6703:Vmn2r106 UTSW 17 20268463 missense probably damaging 1.00
R6730:Vmn2r106 UTSW 17 20278834 missense possibly damaging 0.64
R6961:Vmn2r106 UTSW 17 20268384 nonsense probably null
R7054:Vmn2r106 UTSW 17 20278920 missense probably damaging 0.96
R7379:Vmn2r106 UTSW 17 20267775 missense possibly damaging 0.75
R7402:Vmn2r106 UTSW 17 20267621 missense probably damaging 0.99
R7497:Vmn2r106 UTSW 17 20267939 missense probably damaging 1.00
R7692:Vmn2r106 UTSW 17 20285228 missense possibly damaging 0.96
Predicted Primers PCR Primer
(F):5'- TGAGAGCTCGGTTATTGGCC -3'
(R):5'- AGGCTAGTTCAACTTCAGTCAG -3'

Sequencing Primer
(F):5'- GCCTTGACAATAGGAGTGTCTC -3'
(R):5'- GTTCAACTTCAGTCAGTATAAGGAAG -3'
Posted On2018-05-24