Incidental Mutation 'R6428:Gm1141'
ID518407
Institutional Source Beutler Lab
Gene Symbol Gm1141
Ensembl Gene ENSMUSG00000073130
Gene Namepredicted gene 1141
SynonymsLOC382221, Pasd1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.123) question?
Stock #R6428 (G1)
Quality Score214.458
Status Not validated
ChromosomeX
Chromosomal Location71921002-71940870 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) CATCTTTACCATCATGTCAAGTATCTTTACCATCATGTCAAGTATCTTTACC to CATCTTTACCATCATGTCAAGTATCTTTACC at 71939520 bp
ZygosityHomozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000101495]
Predicted Effect probably benign
Transcript: ENSMUST00000101495
SMART Domains Protein: ENSMUSP00000099034
Gene: ENSMUSG00000073130

DomainStartEndE-ValueType
low complexity region 28 43 N/A INTRINSIC
low complexity region 48 73 N/A INTRINSIC
low complexity region 147 163 N/A INTRINSIC
low complexity region 255 267 N/A INTRINSIC
low complexity region 284 291 N/A INTRINSIC
low complexity region 419 432 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000154780
SMART Domains Protein: ENSMUSP00000114284
Gene: ENSMUSG00000073130

DomainStartEndE-ValueType
low complexity region 50 60 N/A INTRINSIC
low complexity region 90 105 N/A INTRINSIC
low complexity region 110 135 N/A INTRINSIC
low complexity region 209 225 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abat C T 16: 8,602,436 probably benign Het
Cts6 T G 13: 61,196,423 N272H probably damaging Het
Daam2 C T 17: 49,469,376 E828K probably damaging Het
Dhx9 C T 1: 153,456,578 probably benign Het
Glb1l3 T C 9: 26,859,452 N106S probably damaging Het
Hdlbp T C 1: 93,431,445 D175G possibly damaging Het
Hectd4 A G 5: 121,350,445 K3600E possibly damaging Het
Hspa13 A T 16: 75,757,986 L404Q probably damaging Het
Iws1 A G 18: 32,086,290 D475G probably damaging Het
Klhdc10 T C 6: 30,439,856 S13P probably damaging Het
Lepr C T 4: 101,780,098 T728I probably damaging Het
Ncapd3 A G 9: 27,052,664 probably null Het
Phb2 A G 6: 124,715,991 D276G probably benign Het
Prrc2b A G 2: 32,226,496 probably null Het
Rasgrf2 T C 13: 91,987,981 K604R probably damaging Het
Rp1l1 T A 14: 64,032,389 M1808K possibly damaging Het
Setd3 T C 12: 108,113,338 D302G probably damaging Het
Slc38a10 T A 11: 120,105,472 Q933L probably benign Het
Slco1a1 A G 6: 141,925,690 L250S probably damaging Het
Vmn2r106 C T 17: 20,268,463 C558Y probably damaging Het
Vmn2r26 A G 6: 124,026,080 I150V probably benign Het
Zfp318 C T 17: 46,399,336 R662C probably damaging Het
Other mutations in Gm1141
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0128:Gm1141 UTSW X 71939555 missense possibly damaging 0.83
R0130:Gm1141 UTSW X 71939555 missense possibly damaging 0.83
R0131:Gm1141 UTSW X 71939555 missense possibly damaging 0.83
R0629:Gm1141 UTSW X 71938773 missense possibly damaging 0.90
R4156:Gm1141 UTSW X 71939555 missense possibly damaging 0.83
R4157:Gm1141 UTSW X 71939555 missense possibly damaging 0.83
R4416:Gm1141 UTSW X 71939619 missense possibly damaging 0.83
R4417:Gm1141 UTSW X 71939619 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- TGTTACATGCTGTGAAGAGCC -3'
(R):5'- ATACTTGACGTGAAGTTGTCGAAG -3'

Sequencing Primer
(F):5'- CCCGGATCAGATTATATGCAGCATG -3'
(R):5'- AGGTTGACGTGACACTGC -3'
Posted On2018-05-24