Incidental Mutation 'R6429:Dpp10'
ID518408
Institutional Source Beutler Lab
Gene Symbol Dpp10
Ensembl Gene ENSMUSG00000036815
Gene Namedipeptidylpeptidase 10
Synonyms6430601K09Rik, DPRP3
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6429 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location123321471-124045559 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 123367601 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 570 (I570T)
Ref Sequence ENSEMBL: ENSMUSP00000108225 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112603] [ENSMUST00000112606]
Predicted Effect probably benign
Transcript: ENSMUST00000112603
AA Change: I559T

PolyPhen 2 Score 0.035 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000108222
Gene: ENSMUSG00000036815
AA Change: I559T

DomainStartEndE-ValueType
low complexity region 10 25 N/A INTRINSIC
Pfam:DPPIV_N 83 450 4.9e-118 PFAM
Pfam:Peptidase_S9 530 734 6.4e-47 PFAM
Pfam:DLH 556 711 1.4e-6 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000112606
AA Change: I570T

PolyPhen 2 Score 0.718 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000108225
Gene: ENSMUSG00000036815
AA Change: I570T

DomainStartEndE-ValueType
transmembrane domain 38 60 N/A INTRINSIC
low complexity region 64 79 N/A INTRINSIC
Pfam:DPPIV_N 137 504 4.4e-115 PFAM
Pfam:Peptidase_S9 584 788 8.6e-48 PFAM
Pfam:DLH 604 774 1.1e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193624
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194472
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a single-pass type II membrane protein that is a member of the S9B family in clan SC of the serine proteases. This protein has no detectable protease activity, most likely due to the absence of the conserved serine residue normally present in the catalytic domain of serine proteases. However, it does bind specific voltage-gated potassium channels and alters their expression and biophysical properties. Mutations in this gene have been associated with asthma. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130019O22Rik T C 7: 127,385,042 probably benign Het
Acacb G A 5: 114,228,591 E1565K probably damaging Het
Amy1 T C 3: 113,569,509 N63S probably damaging Het
Arhgef15 G T 11: 68,947,796 N591K probably damaging Het
AW551984 A G 9: 39,600,614 S34P probably damaging Het
C2cd3 A G 7: 100,432,091 D127G probably damaging Het
Ccdc87 T A 19: 4,841,235 V585E probably benign Het
Cul2 T C 18: 3,421,345 I223T probably damaging Het
Dgkq C T 5: 108,653,708 V495M probably damaging Het
Dstyk C T 1: 132,449,804 Q383* probably null Het
Emilin2 C A 17: 71,310,956 probably benign Het
Fnip1 A G 11: 54,515,567 I1163M probably damaging Het
Fryl C T 5: 73,090,751 E1008K possibly damaging Het
Gm15448 A T 7: 3,822,346 H432Q possibly damaging Het
Gm35315 A T 5: 110,078,659 Y305N possibly damaging Het
Grhl3 T A 4: 135,557,196 D195V probably damaging Het
Il33 T C 19: 29,952,000 F41S probably benign Het
Il4 A G 11: 53,613,909 S15P possibly damaging Het
Inf2 C T 12: 112,604,256 P410S probably benign Het
Kalrn T A 16: 34,332,164 D349V possibly damaging Het
Krt4 A G 15: 101,922,794 M224T probably benign Het
Lrp2 C T 2: 69,461,287 S3516N probably damaging Het
Macf1 A T 4: 123,401,594 probably null Het
Msr1 G A 8: 39,615,817 P213S probably damaging Het
Nptx1 G T 11: 119,544,721 C256* probably null Het
Nr1d1 T C 11: 98,772,014 Y51C probably damaging Het
Olfr1205 G A 2: 88,831,525 R136Q probably benign Het
Panx3 T C 9: 37,661,165 D363G probably damaging Het
Prkag1 A G 15: 98,814,523 F143L probably damaging Het
Ptger4 T C 15: 5,242,997 K72R possibly damaging Het
Pvrig A G 5: 138,342,050 T28A probably benign Het
Rhod C T 19: 4,426,105 C206Y probably benign Het
Rngtt C A 4: 33,320,606 S51* probably null Het
Rreb1 T G 13: 37,932,129 S1155A probably benign Het
Scn9a A C 2: 66,526,963 I998S possibly damaging Het
Sfmbt1 T A 14: 30,773,911 F50L probably damaging Het
Six4 A T 12: 73,103,473 V766D probably damaging Het
Smpd1 T C 7: 105,556,928 I421T probably damaging Het
Son T A 16: 91,658,166 M1267K probably benign Het
Styk1 T A 6: 131,310,064 D156V possibly damaging Het
Supt3 A G 17: 45,119,143 E361G probably benign Het
Tbx3 T A 5: 119,674,191 Y185* probably null Het
Tmem2 T C 19: 21,801,908 C361R probably benign Het
Trpm1 A T 7: 64,268,504 T531S probably benign Het
Tspan32 T A 7: 143,018,742 W172R possibly damaging Het
Ttc26 T A 6: 38,398,313 S250T possibly damaging Het
Urb1 A T 16: 90,762,430 probably null Het
Vmn2r70 T A 7: 85,559,068 I734F probably damaging Het
Vwa7 A G 17: 35,024,199 T618A probably benign Het
Wac T A 18: 7,920,163 V339E probably damaging Het
Wrn G A 8: 33,342,996 T156M probably damaging Het
Zeb1 T A 18: 5,770,498 C884S probably damaging Het
Zmpste24 A G 4: 121,095,670 V10A probably damaging Het
Other mutations in Dpp10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01592:Dpp10 APN 1 123334370 missense probably damaging 1.00
IGL01618:Dpp10 APN 1 123367867 missense probably benign
IGL02101:Dpp10 APN 1 123411826 missense probably damaging 1.00
IGL02284:Dpp10 APN 1 124045366 splice site probably benign
IGL02324:Dpp10 APN 1 123367802 missense probably benign 0.02
IGL02391:Dpp10 APN 1 123650358 missense probably damaging 0.98
IGL02458:Dpp10 APN 1 123341689 missense probably benign 0.01
IGL02469:Dpp10 APN 1 123411803 missense probably benign 0.01
IGL02501:Dpp10 APN 1 123686270 missense possibly damaging 0.93
IGL02522:Dpp10 APN 1 123423652 missense probably benign 0.24
IGL02672:Dpp10 APN 1 123376647 missense probably benign 0.45
IGL03034:Dpp10 APN 1 123341619 missense probably damaging 1.00
PIT1430001:Dpp10 UTSW 1 123341182 splice site probably benign
R0104:Dpp10 UTSW 1 123367843 missense probably benign 0.00
R0114:Dpp10 UTSW 1 123486092 missense probably benign 0.07
R0242:Dpp10 UTSW 1 123398546 missense possibly damaging 0.56
R0242:Dpp10 UTSW 1 123398546 missense possibly damaging 0.56
R0682:Dpp10 UTSW 1 123905125 missense probably damaging 0.98
R0815:Dpp10 UTSW 1 123432929 critical splice donor site probably null
R1549:Dpp10 UTSW 1 123341380 critical splice acceptor site probably null
R1742:Dpp10 UTSW 1 123445206 missense probably damaging 1.00
R1859:Dpp10 UTSW 1 123353604 missense possibly damaging 0.47
R1991:Dpp10 UTSW 1 123905106 missense probably null 1.00
R1992:Dpp10 UTSW 1 123905106 missense probably null 1.00
R2079:Dpp10 UTSW 1 123432992 missense probably damaging 1.00
R2882:Dpp10 UTSW 1 123445203 missense probably damaging 1.00
R2974:Dpp10 UTSW 1 123411705 splice site probably benign
R3827:Dpp10 UTSW 1 123411790 missense possibly damaging 0.56
R3852:Dpp10 UTSW 1 123485924 nonsense probably null
R3876:Dpp10 UTSW 1 123353487 missense probably damaging 0.98
R3899:Dpp10 UTSW 1 123353557 missense probably damaging 1.00
R4735:Dpp10 UTSW 1 123398627 missense probably benign 0.15
R4922:Dpp10 UTSW 1 123378153 missense probably benign 0.44
R5457:Dpp10 UTSW 1 123411810 missense possibly damaging 0.51
R5599:Dpp10 UTSW 1 123905076 missense probably damaging 0.99
R5913:Dpp10 UTSW 1 123384289 missense probably damaging 1.00
R5979:Dpp10 UTSW 1 123384283 critical splice donor site probably null
R6378:Dpp10 UTSW 1 123411739 missense probably damaging 1.00
R6505:Dpp10 UTSW 1 123336851 missense probably damaging 0.99
R6776:Dpp10 UTSW 1 123367656 nonsense probably null
R6894:Dpp10 UTSW 1 123336864 missense probably damaging 1.00
R6951:Dpp10 UTSW 1 123341650 missense possibly damaging 0.93
R7182:Dpp10 UTSW 1 123341151 missense probably benign 0.15
R7246:Dpp10 UTSW 1 123334377 missense probably damaging 1.00
R7297:Dpp10 UTSW 1 123353428 nonsense probably null
R7375:Dpp10 UTSW 1 123367795 missense probably benign
R7387:Dpp10 UTSW 1 123341140 missense probably benign 0.01
R7661:Dpp10 UTSW 1 123384952 missense probably damaging 1.00
R8065:Dpp10 UTSW 1 123352660 missense probably benign
R8067:Dpp10 UTSW 1 123352660 missense probably benign
R8260:Dpp10 UTSW 1 123686295 missense probably benign
R8324:Dpp10 UTSW 1 123854172 missense probably benign 0.02
R8373:Dpp10 UTSW 1 123854229 missense possibly damaging 0.94
R8434:Dpp10 UTSW 1 123433010 missense probably damaging 1.00
X0019:Dpp10 UTSW 1 123398585 missense possibly damaging 0.88
X0020:Dpp10 UTSW 1 123398582 missense probably benign 0.36
X0021:Dpp10 UTSW 1 123432992 missense probably damaging 1.00
X0024:Dpp10 UTSW 1 123384286 missense probably damaging 1.00
Z1176:Dpp10 UTSW 1 123353440 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CCCATTAAGTTGACAGTCTTCCTAGC -3'
(R):5'- ACTATTCAGAAGAAGAAGCTCGC -3'

Sequencing Primer
(F):5'- TCTGGGCCCATCTACAAGAGATTG -3'
(R):5'- TGATGACTATGGTAAAAATTGGCAC -3'
Posted On2018-05-24