Mutagenetix > Incidental Mutation

Incidental Mutation 'R6429:Dpp10'

518408

Institutional Source

Beutler Lab

Gene Symbol

Dpp10

Ensembl Gene

ENSMUSG00000036815

Gene Name

dipeptidylpeptidase 10

Synonyms

6430601K09Rik, DPRP3

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6429 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

123321471-124045559 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 123367601 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 570 (I570T)

Ref Sequence

ENSEMBL: ENSMUSP00000108225 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000112603] [ENSMUST00000112606]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000112603
AA Change: I559T

PolyPhen 2 Score 0.035 (Sensitivity: 0.94; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000108222
Gene: ENSMUSG00000036815
AA Change: I559T

Domain	Start	End	E-Value	Type
low complexity region	10	25	N/A	INTRINSIC
Pfam:DPPIV_N	83	450	4.9e-118	PFAM
Pfam:Peptidase_S9	530	734	6.4e-47	PFAM
Pfam:DLH	556	711	1.4e-6	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000112606
AA Change: I570T

PolyPhen 2 Score 0.718 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000108225
Gene: ENSMUSG00000036815
AA Change: I570T

Domain	Start	End	E-Value	Type
transmembrane domain	38	60	N/A	INTRINSIC
low complexity region	64	79	N/A	INTRINSIC
Pfam:DPPIV_N	137	504	4.4e-115	PFAM
Pfam:Peptidase_S9	584	788	8.6e-48	PFAM
Pfam:DLH	604	774	1.1e-7	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000193624

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000194472

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.6%
20x: 92.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a single-pass type II membrane protein that is a member of the S9B family in clan SC of the serine proteases. This protein has no detectable protease activity, most likely due to the absence of the conserved serine residue normally present in the catalytic domain of serine proteases. However, it does bind specific voltage-gated potassium channels and alters their expression and biophysical properties. Mutations in this gene have been associated with asthma. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9130019O22Rik	T	C	7: 127,385,042		probably benign	Het
Acacb	G	A	5: 114,228,591	E1565K	probably damaging	Het
Amy1	T	C	3: 113,569,509	N63S	probably damaging	Het
Arhgef15	G	T	11: 68,947,796	N591K	probably damaging	Het
AW551984	A	G	9: 39,600,614	S34P	probably damaging	Het
C2cd3	A	G	7: 100,432,091	D127G	probably damaging	Het
Ccdc87	T	A	19: 4,841,235	V585E	probably benign	Het
Cul2	T	C	18: 3,421,345	I223T	probably damaging	Het
Dgkq	C	T	5: 108,653,708	V495M	probably damaging	Het
Dstyk	C	T	1: 132,449,804	Q383*	probably null	Het
Emilin2	C	A	17: 71,310,956		probably benign	Het
Fnip1	A	G	11: 54,515,567	I1163M	probably damaging	Het
Fryl	C	T	5: 73,090,751	E1008K	possibly damaging	Het
Gm15448	A	T	7: 3,822,346	H432Q	possibly damaging	Het
Gm35315	A	T	5: 110,078,659	Y305N	possibly damaging	Het
Grhl3	T	A	4: 135,557,196	D195V	probably damaging	Het
Il33	T	C	19: 29,952,000	F41S	probably benign	Het
Il4	A	G	11: 53,613,909	S15P	possibly damaging	Het
Inf2	C	T	12: 112,604,256	P410S	probably benign	Het
Kalrn	T	A	16: 34,332,164	D349V	possibly damaging	Het
Krt4	A	G	15: 101,922,794	M224T	probably benign	Het
Lrp2	C	T	2: 69,461,287	S3516N	probably damaging	Het
Macf1	A	T	4: 123,401,594		probably null	Het
Msr1	G	A	8: 39,615,817	P213S	probably damaging	Het
Nptx1	G	T	11: 119,544,721	C256*	probably null	Het
Nr1d1	T	C	11: 98,772,014	Y51C	probably damaging	Het
Olfr1205	G	A	2: 88,831,525	R136Q	probably benign	Het
Panx3	T	C	9: 37,661,165	D363G	probably damaging	Het
Prkag1	A	G	15: 98,814,523	F143L	probably damaging	Het
Ptger4	T	C	15: 5,242,997	K72R	possibly damaging	Het
Pvrig	A	G	5: 138,342,050	T28A	probably benign	Het
Rhod	C	T	19: 4,426,105	C206Y	probably benign	Het
Rngtt	C	A	4: 33,320,606	S51*	probably null	Het
Rreb1	T	G	13: 37,932,129	S1155A	probably benign	Het
Scn9a	A	C	2: 66,526,963	I998S	possibly damaging	Het
Sfmbt1	T	A	14: 30,773,911	F50L	probably damaging	Het
Six4	A	T	12: 73,103,473	V766D	probably damaging	Het
Smpd1	T	C	7: 105,556,928	I421T	probably damaging	Het
Son	T	A	16: 91,658,166	M1267K	probably benign	Het
Styk1	T	A	6: 131,310,064	D156V	possibly damaging	Het
Supt3	A	G	17: 45,119,143	E361G	probably benign	Het
Tbx3	T	A	5: 119,674,191	Y185*	probably null	Het
Tmem2	T	C	19: 21,801,908	C361R	probably benign	Het
Trpm1	A	T	7: 64,268,504	T531S	probably benign	Het
Tspan32	T	A	7: 143,018,742	W172R	possibly damaging	Het
Ttc26	T	A	6: 38,398,313	S250T	possibly damaging	Het
Urb1	A	T	16: 90,762,430		probably null	Het
Vmn2r70	T	A	7: 85,559,068	I734F	probably damaging	Het
Vwa7	A	G	17: 35,024,199	T618A	probably benign	Het
Wac	T	A	18: 7,920,163	V339E	probably damaging	Het
Wrn	G	A	8: 33,342,996	T156M	probably damaging	Het
Zeb1	T	A	18: 5,770,498	C884S	probably damaging	Het
Zmpste24	A	G	4: 121,095,670	V10A	probably damaging	Het

Other mutations in Dpp10

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01592:Dpp10	APN	1	123334370	missense	probably damaging	1.00
IGL01618:Dpp10	APN	1	123367867	missense	probably benign
IGL02101:Dpp10	APN	1	123411826	missense	probably damaging	1.00
IGL02284:Dpp10	APN	1	124045366	splice site	probably benign
IGL02324:Dpp10	APN	1	123367802	missense	probably benign	0.02
IGL02391:Dpp10	APN	1	123650358	missense	probably damaging	0.98
IGL02458:Dpp10	APN	1	123341689	missense	probably benign	0.01
IGL02469:Dpp10	APN	1	123411803	missense	probably benign	0.01
IGL02501:Dpp10	APN	1	123686270	missense	possibly damaging	0.93
IGL02522:Dpp10	APN	1	123423652	missense	probably benign	0.24
IGL02672:Dpp10	APN	1	123376647	missense	probably benign	0.45
IGL03034:Dpp10	APN	1	123341619	missense	probably damaging	1.00
PIT1430001:Dpp10	UTSW	1	123341182	splice site	probably benign
R0104:Dpp10	UTSW	1	123367843	missense	probably benign	0.00
R0114:Dpp10	UTSW	1	123486092	missense	probably benign	0.07
R0242:Dpp10	UTSW	1	123398546	missense	possibly damaging	0.56
R0242:Dpp10	UTSW	1	123398546	missense	possibly damaging	0.56
R0682:Dpp10	UTSW	1	123905125	missense	probably damaging	0.98
R0815:Dpp10	UTSW	1	123432929	critical splice donor site	probably null
R1549:Dpp10	UTSW	1	123341380	critical splice acceptor site	probably null
R1742:Dpp10	UTSW	1	123445206	missense	probably damaging	1.00
R1859:Dpp10	UTSW	1	123353604	missense	possibly damaging	0.47
R1991:Dpp10	UTSW	1	123905106	missense	probably null	1.00
R1992:Dpp10	UTSW	1	123905106	missense	probably null	1.00
R2079:Dpp10	UTSW	1	123432992	missense	probably damaging	1.00
R2882:Dpp10	UTSW	1	123445203	missense	probably damaging	1.00
R2974:Dpp10	UTSW	1	123411705	splice site	probably benign
R3827:Dpp10	UTSW	1	123411790	missense	possibly damaging	0.56
R3852:Dpp10	UTSW	1	123485924	nonsense	probably null
R3876:Dpp10	UTSW	1	123353487	missense	probably damaging	0.98
R3899:Dpp10	UTSW	1	123353557	missense	probably damaging	1.00
R4735:Dpp10	UTSW	1	123398627	missense	probably benign	0.15
R4922:Dpp10	UTSW	1	123378153	missense	probably benign	0.44
R5457:Dpp10	UTSW	1	123411810	missense	possibly damaging	0.51
R5599:Dpp10	UTSW	1	123905076	missense	probably damaging	0.99
R5913:Dpp10	UTSW	1	123384289	missense	probably damaging	1.00
R5979:Dpp10	UTSW	1	123384283	critical splice donor site	probably null
R6378:Dpp10	UTSW	1	123411739	missense	probably damaging	1.00
R6505:Dpp10	UTSW	1	123336851	missense	probably damaging	0.99
R6776:Dpp10	UTSW	1	123367656	nonsense	probably null
R6894:Dpp10	UTSW	1	123336864	missense	probably damaging	1.00
R6951:Dpp10	UTSW	1	123341650	missense	possibly damaging	0.93
R7182:Dpp10	UTSW	1	123341151	missense	probably benign	0.15
R7246:Dpp10	UTSW	1	123334377	missense	probably damaging	1.00
R7297:Dpp10	UTSW	1	123353428	nonsense	probably null
R7375:Dpp10	UTSW	1	123367795	missense	probably benign
R7387:Dpp10	UTSW	1	123341140	missense	probably benign	0.01
R7661:Dpp10	UTSW	1	123384952	missense	probably damaging	1.00
R8065:Dpp10	UTSW	1	123352660	missense	probably benign
R8067:Dpp10	UTSW	1	123352660	missense	probably benign
R8260:Dpp10	UTSW	1	123686295	missense	probably benign
R8324:Dpp10	UTSW	1	123854172	missense	probably benign	0.02
R8373:Dpp10	UTSW	1	123854229	missense	possibly damaging	0.94
R8434:Dpp10	UTSW	1	123433010	missense	probably damaging	1.00
R9068:Dpp10	UTSW	1	123432938	missense	probably damaging	1.00
R9104:Dpp10	UTSW	1	123411755	missense	probably damaging	1.00
R9477:Dpp10	UTSW	1	123376641	missense	possibly damaging	0.46
R9492:Dpp10	UTSW	1	123353430	missense	probably damaging	1.00
R9524:Dpp10	UTSW	1	123336882	missense	probably damaging	1.00
R9576:Dpp10	UTSW	1	123341680	missense	probably damaging	1.00
R9631:Dpp10	UTSW	1	123341703	missense	probably damaging	1.00
R9736:Dpp10	UTSW	1	123334359	missense	possibly damaging	0.64
X0019:Dpp10	UTSW	1	123398585	missense	possibly damaging	0.88
X0020:Dpp10	UTSW	1	123398582	missense	probably benign	0.36
X0021:Dpp10	UTSW	1	123432992	missense	probably damaging	1.00
X0024:Dpp10	UTSW	1	123384286	missense	probably damaging	1.00
Z1176:Dpp10	UTSW	1	123353440	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- CCCATTAAGTTGACAGTCTTCCTAGC -3'
(R):5'- ACTATTCAGAAGAAGAAGCTCGC -3'

Sequencing Primer
(F):5'- TCTGGGCCCATCTACAAGAGATTG -3'
(R):5'- TGATGACTATGGTAAAAATTGGCAC -3'

Posted On

2018-05-24