Mutagenetix > Incidental Mutations

Incidental Mutation 'R6429:Olfr1205'

518412

Institutional Source

Beutler Lab

Gene Symbol

Olfr1205

Ensembl Gene

ENSMUSG00000057447

Gene Name

olfactory receptor 1205

Synonyms

MOR230-1, MOR230-3, Olfr1203, GA_x6K02T2Q125-50304328-50305251, GA_x6K02T2Q125-50336588-50337313

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.057) question?

Stock #

R6429 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

88829737-88837104 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 88831525 bp

Zygosity

Heterozygous

Amino Acid Change

Arginine to Glutamine at position 136 (R136Q)

Ref Sequence

ENSEMBL: ENSMUSP00000150206 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000076438] [ENSMUST00000215929]

Predicted Effect

probably benign
Transcript: ENSMUST00000076438
AA Change: R136Q

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000075769
Gene: ENSMUSG00000057447
AA Change: R136Q

Domain	Start	End	E-Value	Type
Pfam:7tm_4	29	303	5e-45	PFAM
Pfam:7tm_1	39	285	9.1e-21	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000215929
AA Change: R136Q

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.6%
20x: 92.6%

Validation Efficiency

MGI Phenotype

FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9130019O22Rik	T	C	7: 127,385,042		probably benign	Het
Acacb	G	A	5: 114,228,591	E1565K	probably damaging	Het
Amy1	T	C	3: 113,569,509	N63S	probably damaging	Het
Arhgef15	G	T	11: 68,947,796	N591K	probably damaging	Het
AW551984	A	G	9: 39,600,614	S34P	probably damaging	Het
C2cd3	A	G	7: 100,432,091	D127G	probably damaging	Het
Ccdc87	T	A	19: 4,841,235	V585E	probably benign	Het
Cul2	T	C	18: 3,421,345	I223T	probably damaging	Het
Dgkq	C	T	5: 108,653,708	V495M	probably damaging	Het
Dpp10	A	G	1: 123,367,601	I570T	possibly damaging	Het
Dstyk	C	T	1: 132,449,804	Q383*	probably null	Het
Emilin2	C	A	17: 71,310,956		probably benign	Het
Fnip1	A	G	11: 54,515,567	I1163M	probably damaging	Het
Fryl	C	T	5: 73,090,751	E1008K	possibly damaging	Het
Gm15448	A	T	7: 3,822,346	H432Q	possibly damaging	Het
Gm35315	A	T	5: 110,078,659	Y305N	possibly damaging	Het
Grhl3	T	A	4: 135,557,196	D195V	probably damaging	Het
Il33	T	C	19: 29,952,000	F41S	probably benign	Het
Il4	A	G	11: 53,613,909	S15P	possibly damaging	Het
Inf2	C	T	12: 112,604,256	P410S	probably benign	Het
Kalrn	T	A	16: 34,332,164	D349V	possibly damaging	Het
Krt4	A	G	15: 101,922,794	M224T	probably benign	Het
Lrp2	C	T	2: 69,461,287	S3516N	probably damaging	Het
Macf1	A	T	4: 123,401,594		probably null	Het
Msr1	G	A	8: 39,615,817	P213S	probably damaging	Het
Nptx1	G	T	11: 119,544,721	C256*	probably null	Het
Nr1d1	T	C	11: 98,772,014	Y51C	probably damaging	Het
Panx3	T	C	9: 37,661,165	D363G	probably damaging	Het
Prkag1	A	G	15: 98,814,523	F143L	probably damaging	Het
Ptger4	T	C	15: 5,242,997	K72R	possibly damaging	Het
Pvrig	A	G	5: 138,342,050	T28A	probably benign	Het
Rhod	C	T	19: 4,426,105	C206Y	probably benign	Het
Rngtt	C	A	4: 33,320,606	S51*	probably null	Het
Rreb1	T	G	13: 37,932,129	S1155A	probably benign	Het
Scn9a	A	C	2: 66,526,963	I998S	possibly damaging	Het
Sfmbt1	T	A	14: 30,773,911	F50L	probably damaging	Het
Six4	A	T	12: 73,103,473	V766D	probably damaging	Het
Smpd1	T	C	7: 105,556,928	I421T	probably damaging	Het
Son	T	A	16: 91,658,166	M1267K	probably benign	Het
Styk1	T	A	6: 131,310,064	D156V	possibly damaging	Het
Supt3	A	G	17: 45,119,143	E361G	probably benign	Het
Tbx3	T	A	5: 119,674,191	Y185*	probably null	Het
Tmem2	T	C	19: 21,801,908	C361R	probably benign	Het
Trpm1	A	T	7: 64,268,504	T531S	probably benign	Het
Tspan32	T	A	7: 143,018,742	W172R	possibly damaging	Het
Ttc26	T	A	6: 38,398,313	S250T	possibly damaging	Het
Urb1	A	T	16: 90,762,430		probably null	Het
Vmn2r70	T	A	7: 85,559,068	I734F	probably damaging	Het
Vwa7	A	G	17: 35,024,199	T618A	probably benign	Het
Wac	T	A	18: 7,920,163	V339E	probably damaging	Het
Wrn	G	A	8: 33,342,996	T156M	probably damaging	Het
Zeb1	T	A	18: 5,770,498	C884S	probably damaging	Het
Zmpste24	A	G	4: 121,095,670	V10A	probably damaging	Het

Other mutations in Olfr1205

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00923:Olfr1205	APN	2	88831112	splice site	probably null
IGL02079:Olfr1205	APN	2	88831647	missense	probably damaging	1.00
IGL02183:Olfr1205	APN	2	88832028	missense	probably benign
IGL02813:Olfr1205	APN	2	88831151	missense	probably benign	0.34
IGL02839:Olfr1205	APN	2	88831648	missense	probably damaging	1.00
IGL02895:Olfr1205	APN	2	88831642	missense	probably damaging	1.00
R0680:Olfr1205	UTSW	2	88831780	missense	probably benign
R2029:Olfr1205	UTSW	2	88831405	missense	possibly damaging	0.88
R2095:Olfr1205	UTSW	2	88831290	missense	probably damaging	1.00
R6158:Olfr1205	UTSW	2	88831146	missense	probably damaging	1.00
R6216:Olfr1205	UTSW	2	88831311	missense	probably damaging	1.00
R6240:Olfr1205	UTSW	2	88831363	missense	probably benign	0.22
R6377:Olfr1205	UTSW	2	88831269	nonsense	probably null
R6521:Olfr1205	UTSW	2	88831356	missense	probably benign	0.03
R7065:Olfr1205	UTSW	2	88831386	missense	probably damaging	1.00
R7343:Olfr1205	UTSW	2	88831846	missense	probably damaging	1.00
R7476:Olfr1205	UTSW	2	88831588	missense	probably benign	0.07
R7570:Olfr1205	UTSW	2	88831128	missense	possibly damaging	0.82
R8303:Olfr1205	UTSW	2	88831289	missense	possibly damaging	0.90
R8306:Olfr1205	UTSW	2	88831289	missense	possibly damaging	0.90
R8307:Olfr1205	UTSW	2	88831289	missense	possibly damaging	0.90
R8308:Olfr1205	UTSW	2	88831289	missense	possibly damaging	0.90
R8344:Olfr1205	UTSW	2	88831383	missense	probably benign	0.00
R8386:Olfr1205	UTSW	2	88831289	missense	possibly damaging	0.90
R8387:Olfr1205	UTSW	2	88831289	missense	possibly damaging	0.90
Z1176:Olfr1205	UTSW	2	88831578	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- GGGGTCCCATGTACTTCTTC -3'
(R):5'- ATGTGTGTATCCATGCAGGC -3'

Sequencing Primer
(F):5'- AGCCCCAAGACTCATTGTGGATG -3'
(R):5'- TGTATCCATGCAGGCAAGCTC -3'

Posted On

2018-05-24