Incidental Mutation 'R6429:Amy1'
ID 518413
Institutional Source Beutler Lab
Gene Symbol Amy1
Ensembl Gene ENSMUSG00000074264
Gene Name amylase 1, salivary
Synonyms Amy-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.115) question?
Stock # R6429 (G1)
Quality Score 225.009
Status Not validated
Chromosome 3
Chromosomal Location 113555710-113606699 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 113569509 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 63 (N63S)
Ref Sequence ENSEMBL: ENSMUSP00000133875 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067980] [ENSMUST00000106540] [ENSMUST00000142505] [ENSMUST00000174147]
AlphaFold P00687
Predicted Effect probably damaging
Transcript: ENSMUST00000067980
AA Change: N63S

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000070368
Gene: ENSMUSG00000074264
AA Change: N63S

DomainStartEndE-ValueType
Aamy 26 413 6.31e-97 SMART
Aamy_C 422 510 4.02e-49 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000106540
AA Change: N63S

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000102150
Gene: ENSMUSG00000074264
AA Change: N63S

DomainStartEndE-ValueType
Aamy 26 413 6.31e-97 SMART
Aamy_C 422 510 4.02e-49 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000142505
AA Change: N63S

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000120493
Gene: ENSMUSG00000074264
AA Change: N63S

DomainStartEndE-ValueType
Pfam:Alpha-amylase 36 271 1.4e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000174147
AA Change: N63S

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000133875
Gene: ENSMUSG00000074264
AA Change: N63S

DomainStartEndE-ValueType
Pfam:Alpha-amylase 35 129 2e-10 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the alpha-amylase family of proteins. Amylases are secreted proteins that hydrolyze 1,4-alpha-glucoside bonds in oligosaccharides and polysaccharides, catalyzing the first step in digestion of dietary starch and glycogen. This gene and several family members are present in a gene cluster on chromosome 1. This gene encodes an amylase isoenzyme produced by the pancreas. [provided by RefSeq, Jan 2015]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130019O22Rik T C 7: 127,385,042 probably benign Het
Acacb G A 5: 114,228,591 E1565K probably damaging Het
Arhgef15 G T 11: 68,947,796 N591K probably damaging Het
AW551984 A G 9: 39,600,614 S34P probably damaging Het
C2cd3 A G 7: 100,432,091 D127G probably damaging Het
Ccdc87 T A 19: 4,841,235 V585E probably benign Het
Cul2 T C 18: 3,421,345 I223T probably damaging Het
Dgkq C T 5: 108,653,708 V495M probably damaging Het
Dpp10 A G 1: 123,367,601 I570T possibly damaging Het
Dstyk C T 1: 132,449,804 Q383* probably null Het
Emilin2 C A 17: 71,310,956 probably benign Het
Fnip1 A G 11: 54,515,567 I1163M probably damaging Het
Fryl C T 5: 73,090,751 E1008K possibly damaging Het
Gm15448 A T 7: 3,822,346 H432Q possibly damaging Het
Gm35315 A T 5: 110,078,659 Y305N possibly damaging Het
Grhl3 T A 4: 135,557,196 D195V probably damaging Het
Il33 T C 19: 29,952,000 F41S probably benign Het
Il4 A G 11: 53,613,909 S15P possibly damaging Het
Inf2 C T 12: 112,604,256 P410S probably benign Het
Kalrn T A 16: 34,332,164 D349V possibly damaging Het
Krt4 A G 15: 101,922,794 M224T probably benign Het
Lrp2 C T 2: 69,461,287 S3516N probably damaging Het
Macf1 A T 4: 123,401,594 probably null Het
Msr1 G A 8: 39,615,817 P213S probably damaging Het
Nptx1 G T 11: 119,544,721 C256* probably null Het
Nr1d1 T C 11: 98,772,014 Y51C probably damaging Het
Olfr1205 G A 2: 88,831,525 R136Q probably benign Het
Panx3 T C 9: 37,661,165 D363G probably damaging Het
Prkag1 A G 15: 98,814,523 F143L probably damaging Het
Ptger4 T C 15: 5,242,997 K72R possibly damaging Het
Pvrig A G 5: 138,342,050 T28A probably benign Het
Rhod C T 19: 4,426,105 C206Y probably benign Het
Rngtt C A 4: 33,320,606 S51* probably null Het
Rreb1 T G 13: 37,932,129 S1155A probably benign Het
Scn9a A C 2: 66,526,963 I998S possibly damaging Het
Sfmbt1 T A 14: 30,773,911 F50L probably damaging Het
Six4 A T 12: 73,103,473 V766D probably damaging Het
Smpd1 T C 7: 105,556,928 I421T probably damaging Het
Son T A 16: 91,658,166 M1267K probably benign Het
Styk1 T A 6: 131,310,064 D156V possibly damaging Het
Supt3 A G 17: 45,119,143 E361G probably benign Het
Tbx3 T A 5: 119,674,191 Y185* probably null Het
Tmem2 T C 19: 21,801,908 C361R probably benign Het
Trpm1 A T 7: 64,268,504 T531S probably benign Het
Tspan32 T A 7: 143,018,742 W172R possibly damaging Het
Ttc26 T A 6: 38,398,313 S250T possibly damaging Het
Urb1 A T 16: 90,762,430 probably null Het
Vmn2r70 T A 7: 85,559,068 I734F probably damaging Het
Vwa7 A G 17: 35,024,199 T618A probably benign Het
Wac T A 18: 7,920,163 V339E probably damaging Het
Wrn G A 8: 33,342,996 T156M probably damaging Het
Zeb1 T A 18: 5,770,498 C884S probably damaging Het
Zmpste24 A G 4: 121,095,670 V10A probably damaging Het
Other mutations in Amy1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00482:Amy1 APN 3 113556132 missense probably damaging 1.00
IGL00966:Amy1 APN 3 113556040 missense probably benign 0.00
IGL01153:Amy1 APN 3 113556075 missense possibly damaging 0.69
IGL02415:Amy1 APN 3 113563585 missense probably benign 0.27
IGL02555:Amy1 APN 3 113564892 missense probably benign 0.01
IGL02572:Amy1 APN 3 113565073 splice site probably benign
IGL03215:Amy1 APN 3 113556000 missense probably benign
R0196:Amy1 UTSW 3 113569421 missense probably benign
R0230:Amy1 UTSW 3 113558430 missense probably benign 0.02
R0586:Amy1 UTSW 3 113562769 unclassified probably benign
R1789:Amy1 UTSW 3 113558165 missense possibly damaging 0.56
R1823:Amy1 UTSW 3 113562727 missense probably null
R1922:Amy1 UTSW 3 113564895 missense probably damaging 0.97
R2080:Amy1 UTSW 3 113558094 missense probably benign 0.01
R3147:Amy1 UTSW 3 113570048 start gained probably benign
R3437:Amy1 UTSW 3 113556009 missense probably damaging 1.00
R4961:Amy1 UTSW 3 113561849 missense probably damaging 1.00
R4977:Amy1 UTSW 3 113569377 splice site probably null
R5304:Amy1 UTSW 3 113558364 missense probably damaging 1.00
R5500:Amy1 UTSW 3 113562722 missense probably damaging 1.00
R5503:Amy1 UTSW 3 113556060 missense probably benign 0.26
R5706:Amy1 UTSW 3 113556120 missense probably damaging 0.99
R5866:Amy1 UTSW 3 113561920 missense possibly damaging 0.93
R5956:Amy1 UTSW 3 113563662 missense probably benign 0.04
R6110:Amy1 UTSW 3 113561900 missense probably damaging 1.00
R6259:Amy1 UTSW 3 113569410 missense possibly damaging 0.73
R6278:Amy1 UTSW 3 113561690 missense probably damaging 1.00
R6893:Amy1 UTSW 3 113563632 missense probably benign 0.00
R7136:Amy1 UTSW 3 113563599 missense probably damaging 1.00
R7463:Amy1 UTSW 3 113569884 nonsense probably null
R9193:Amy1 UTSW 3 113562629 missense probably benign 0.22
Z1177:Amy1 UTSW 3 113558353 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCAGATTACAGGCCTTACATAAG -3'
(R):5'- TTTTCAGACATCAAGAGGCCC -3'

Sequencing Primer
(F):5'- CAGGCCTTACATAAGAATAATCTCG -3'
(R):5'- CAGACATCAAGAGGCCCTTTTTATTG -3'
Posted On 2018-05-24