Incidental Mutation 'R6429:Amy1'
ID 518413
Institutional Source Beutler Lab
Gene Symbol Amy1
Ensembl Gene ENSMUSG00000074264
Gene Name amylase 1, salivary
Synonyms Amy-1
MMRRC Submission 044567-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.126) question?
Stock # R6429 (G1)
Quality Score 225.009
Status Not validated
Chromosome 3
Chromosomal Location 113349601-113371399 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 113363158 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 63 (N63S)
Ref Sequence ENSEMBL: ENSMUSP00000133875 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067980] [ENSMUST00000106540] [ENSMUST00000142505] [ENSMUST00000174147]
AlphaFold P00687
Predicted Effect probably damaging
Transcript: ENSMUST00000067980
AA Change: N63S

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000070368
Gene: ENSMUSG00000074264
AA Change: N63S

DomainStartEndE-ValueType
Aamy 26 413 6.31e-97 SMART
Aamy_C 422 510 4.02e-49 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000106540
AA Change: N63S

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000102150
Gene: ENSMUSG00000074264
AA Change: N63S

DomainStartEndE-ValueType
Aamy 26 413 6.31e-97 SMART
Aamy_C 422 510 4.02e-49 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000142505
AA Change: N63S

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000120493
Gene: ENSMUSG00000074264
AA Change: N63S

DomainStartEndE-ValueType
Pfam:Alpha-amylase 36 271 1.4e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000174147
AA Change: N63S

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000133875
Gene: ENSMUSG00000074264
AA Change: N63S

DomainStartEndE-ValueType
Pfam:Alpha-amylase 35 129 2e-10 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the alpha-amylase family of proteins. Amylases are secreted proteins that hydrolyze 1,4-alpha-glucoside bonds in oligosaccharides and polysaccharides, catalyzing the first step in digestion of dietary starch and glycogen. This gene and several family members are present in a gene cluster on chromosome 1. This gene encodes an amylase isoenzyme produced by the pancreas. [provided by RefSeq, Jan 2015]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acacb G A 5: 114,366,652 (GRCm39) E1565K probably damaging Het
Arhgef15 G T 11: 68,838,622 (GRCm39) N591K probably damaging Het
AW551984 A G 9: 39,511,910 (GRCm39) S34P probably damaging Het
C2cd3 A G 7: 100,081,298 (GRCm39) D127G probably damaging Het
Ccdc87 T A 19: 4,891,263 (GRCm39) V585E probably benign Het
Cemip2 T C 19: 21,779,272 (GRCm39) C361R probably benign Het
Cul2 T C 18: 3,421,345 (GRCm39) I223T probably damaging Het
Dgkq C T 5: 108,801,574 (GRCm39) V495M probably damaging Het
Dpp10 A G 1: 123,295,330 (GRCm39) I570T possibly damaging Het
Dstyk C T 1: 132,377,542 (GRCm39) Q383* probably null Het
Emilin2 C A 17: 71,617,951 (GRCm39) probably benign Het
Fnip1 A G 11: 54,406,393 (GRCm39) I1163M probably damaging Het
Fryl C T 5: 73,248,094 (GRCm39) E1008K possibly damaging Het
Gm35315 A T 5: 110,226,525 (GRCm39) Y305N possibly damaging Het
Grhl3 T A 4: 135,284,507 (GRCm39) D195V probably damaging Het
Ift56 T A 6: 38,375,248 (GRCm39) S250T possibly damaging Het
Il33 T C 19: 29,929,400 (GRCm39) F41S probably benign Het
Il4 A G 11: 53,504,736 (GRCm39) S15P possibly damaging Het
Inf2 C T 12: 112,570,690 (GRCm39) P410S probably benign Het
Kalrn T A 16: 34,152,534 (GRCm39) D349V possibly damaging Het
Krt4 A G 15: 101,831,229 (GRCm39) M224T probably benign Het
Lrp2 C T 2: 69,291,631 (GRCm39) S3516N probably damaging Het
Macf1 A T 4: 123,295,387 (GRCm39) probably null Het
Msr1 G A 8: 40,068,858 (GRCm39) P213S probably damaging Het
Nptx1 G T 11: 119,435,547 (GRCm39) C256* probably null Het
Nr1d1 T C 11: 98,662,840 (GRCm39) Y51C probably damaging Het
Or4c11c G A 2: 88,661,869 (GRCm39) R136Q probably benign Het
Panx3 T C 9: 37,572,461 (GRCm39) D363G probably damaging Het
Pira13 A T 7: 3,825,345 (GRCm39) H432Q possibly damaging Het
Prkag1 A G 15: 98,712,404 (GRCm39) F143L probably damaging Het
Ptger4 T C 15: 5,272,478 (GRCm39) K72R possibly damaging Het
Pvrig-ps A G 5: 138,340,312 (GRCm39) T28A probably benign Het
Rhod C T 19: 4,476,133 (GRCm39) C206Y probably benign Het
Rngtt C A 4: 33,320,606 (GRCm39) S51* probably null Het
Rreb1 T G 13: 38,116,105 (GRCm39) S1155A probably benign Het
Scn9a A C 2: 66,357,307 (GRCm39) I998S possibly damaging Het
Sfmbt1 T A 14: 30,495,868 (GRCm39) F50L probably damaging Het
Six4 A T 12: 73,150,247 (GRCm39) V766D probably damaging Het
Smpd1 T C 7: 105,206,135 (GRCm39) I421T probably damaging Het
Son T A 16: 91,455,054 (GRCm39) M1267K probably benign Het
Styk1 T A 6: 131,287,027 (GRCm39) D156V possibly damaging Het
Supt3 A G 17: 45,430,030 (GRCm39) E361G probably benign Het
Tbx3 T A 5: 119,812,256 (GRCm39) Y185* probably null Het
Trpm1 A T 7: 63,918,252 (GRCm39) T531S probably benign Het
Tspan32 T A 7: 142,572,479 (GRCm39) W172R possibly damaging Het
Urb1 A T 16: 90,559,318 (GRCm39) probably null Het
Vmn2r70 T A 7: 85,208,276 (GRCm39) I734F probably damaging Het
Vwa7 A G 17: 35,243,175 (GRCm39) T618A probably benign Het
Wac T A 18: 7,920,163 (GRCm39) V339E probably damaging Het
Wrn G A 8: 33,833,024 (GRCm39) T156M probably damaging Het
Zeb1 T A 18: 5,770,498 (GRCm39) C884S probably damaging Het
Zfp747l1 T C 7: 126,984,214 (GRCm39) probably benign Het
Zmpste24 A G 4: 120,952,867 (GRCm39) V10A probably damaging Het
Other mutations in Amy1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00482:Amy1 APN 3 113,349,781 (GRCm39) missense probably damaging 1.00
IGL00966:Amy1 APN 3 113,349,689 (GRCm39) missense probably benign 0.00
IGL01153:Amy1 APN 3 113,349,724 (GRCm39) missense possibly damaging 0.69
IGL02415:Amy1 APN 3 113,357,234 (GRCm39) missense probably benign 0.27
IGL02555:Amy1 APN 3 113,358,541 (GRCm39) missense probably benign 0.01
IGL02572:Amy1 APN 3 113,358,722 (GRCm39) splice site probably benign
IGL03215:Amy1 APN 3 113,349,649 (GRCm39) missense probably benign
R0196:Amy1 UTSW 3 113,363,070 (GRCm39) missense probably benign
R0230:Amy1 UTSW 3 113,352,079 (GRCm39) missense probably benign 0.02
R0586:Amy1 UTSW 3 113,356,418 (GRCm39) unclassified probably benign
R1789:Amy1 UTSW 3 113,351,814 (GRCm39) missense possibly damaging 0.56
R1823:Amy1 UTSW 3 113,356,376 (GRCm39) missense probably null
R1922:Amy1 UTSW 3 113,358,544 (GRCm39) missense probably damaging 0.97
R2080:Amy1 UTSW 3 113,351,743 (GRCm39) missense probably benign 0.01
R3147:Amy1 UTSW 3 113,363,697 (GRCm39) start gained probably benign
R3437:Amy1 UTSW 3 113,349,658 (GRCm39) missense probably damaging 1.00
R4961:Amy1 UTSW 3 113,355,498 (GRCm39) missense probably damaging 1.00
R4977:Amy1 UTSW 3 113,363,026 (GRCm39) splice site probably null
R5304:Amy1 UTSW 3 113,352,013 (GRCm39) missense probably damaging 1.00
R5500:Amy1 UTSW 3 113,356,371 (GRCm39) missense probably damaging 1.00
R5503:Amy1 UTSW 3 113,349,709 (GRCm39) missense probably benign 0.26
R5706:Amy1 UTSW 3 113,349,769 (GRCm39) missense probably damaging 0.99
R5866:Amy1 UTSW 3 113,355,569 (GRCm39) missense possibly damaging 0.93
R5956:Amy1 UTSW 3 113,357,311 (GRCm39) missense probably benign 0.04
R6110:Amy1 UTSW 3 113,355,549 (GRCm39) missense probably damaging 1.00
R6259:Amy1 UTSW 3 113,363,059 (GRCm39) missense possibly damaging 0.73
R6278:Amy1 UTSW 3 113,355,339 (GRCm39) missense probably damaging 1.00
R6893:Amy1 UTSW 3 113,357,281 (GRCm39) missense probably benign 0.00
R7136:Amy1 UTSW 3 113,357,248 (GRCm39) missense probably damaging 1.00
R7463:Amy1 UTSW 3 113,363,533 (GRCm39) nonsense probably null
R9193:Amy1 UTSW 3 113,356,278 (GRCm39) missense probably benign 0.22
Z1177:Amy1 UTSW 3 113,352,002 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCAGATTACAGGCCTTACATAAG -3'
(R):5'- TTTTCAGACATCAAGAGGCCC -3'

Sequencing Primer
(F):5'- CAGGCCTTACATAAGAATAATCTCG -3'
(R):5'- CAGACATCAAGAGGCCCTTTTTATTG -3'
Posted On 2018-05-24