Mutagenetix > Incidental Mutation

Incidental Mutation 'R6429:Macf1'

518416

Institutional Source

Beutler Lab

Gene Symbol

Macf1

Ensembl Gene

ENSMUSG00000028649

Gene Name

microtubule-actin crosslinking factor 1

Synonyms

trabeculin alpha, Acf7, Aclp7

MMRRC Submission

044567-MU

Accession Numbers

Ncbi RefSeq: NM_001199136.1, NM_001199137.1; MGI:108559

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R6429 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

123349633-123684360 bp(-) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

A to T at 123401594 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000114568 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000082108] [ENSMUST00000084301] [ENSMUST00000097897] [ENSMUST00000106213] [ENSMUST00000106220] [ENSMUST00000106224] [ENSMUST00000125447] [ENSMUST00000134458] [ENSMUST00000151346]

AlphaFold

no structure available at present

Predicted Effect

probably null
Transcript: ENSMUST00000082108

SMART Domains

Protein: ENSMUSP00000080755
Gene: ENSMUSG00000028649

Domain	Start	End	E-Value	Type
low complexity region	6	35	N/A	INTRINSIC
low complexity region	65	79	N/A	INTRINSIC
CH	80	179	5.63e-28	SMART
CH	196	293	7.49e-24	SMART
SPEC	317	420	4.11e0	SMART
SPEC	583	680	4.32e-9	SMART
SPEC	683	783	5.75e-5	SMART
Blast:SPEC	790	955	4e-82	BLAST
coiled coil region	1046	1067	N/A	INTRINSIC
SPEC	1278	1407	2.35e0	SMART
SPEC	1425	1533	1.12e-7	SMART
SPEC	1550	1658	3.94e-3	SMART
SPEC	1818	1928	4.03e-9	SMART
SPEC	1935	2041	1.75e-9	SMART
SPEC	2048	2150	5.57e-3	SMART
SPEC	2157	2256	4.56e0	SMART
SPEC	2263	2394	3.46e-1	SMART
SPEC	2401	2506	1.29e-7	SMART
SPEC	2513	2617	1.19e-2	SMART
SPEC	2624	2727	2.7e-1	SMART
SPEC	2734	2837	4.99e-14	SMART
SPEC	2844	2944	1.9e-5	SMART
SPEC	2951	3057	2.83e0	SMART
SPEC	3060	3162	2.14e-4	SMART
SPEC	3169	3273	3.01e-8	SMART
SPEC	3280	3382	4.48e-16	SMART
SPEC	3389	3491	1.26e-10	SMART
SPEC	3498	3600	2.26e-3	SMART
SPEC	3607	3709	4.29e-4	SMART
SPEC	3716	3817	9.99e-14	SMART
SPEC	3824	3930	5.79e-2	SMART
SPEC	3937	4039	6.59e-14	SMART
SPEC	4046	4149	3.7e-17	SMART
SPEC	4156	4258	1.16e-23	SMART
SPEC	4265	4368	3.58e-15	SMART
SPEC	4375	4477	2.61e-17	SMART
SPEC	4484	4587	9.38e-19	SMART
SPEC	4594	4695	2.29e-22	SMART
SPEC	4702	4804	4.99e-14	SMART
SPEC	4811	4941	1.45e-10	SMART
EFh	4979	5007	5.08e-3	SMART
EFh	5015	5043	1.17e-2	SMART
GAS2	5054	5132	8.5e-54	SMART
low complexity region	5154	5199	N/A	INTRINSIC
low complexity region	5248	5273	N/A	INTRINSIC
low complexity region	5290	5302	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000084301

SMART Domains

Protein: ENSMUSP00000081324
Gene: ENSMUSG00000028649

Domain	Start	End	E-Value	Type
low complexity region	6	35	N/A	INTRINSIC
low complexity region	65	79	N/A	INTRINSIC
CH	80	179	2.8e-30	SMART
CH	196	293	3.6e-26	SMART
SPEC	317	420	2.6e-2	SMART
SPEC	583	680	2.7e-11	SMART
SPEC	683	783	3.6e-7	SMART
Blast:SPEC	790	955	5e-82	BLAST
coiled coil region	1046	1067	N/A	INTRINSIC
SPEC	1278	1407	1.5e-2	SMART
SPEC	1425	1533	6.9e-10	SMART
PLEC	1530	1576	5.3e-6	SMART
PLEC	1577	1614	1.2e-2	SMART
PLEC	1616	1653	8.7e-2	SMART
PLEC	1654	1691	8.3e-2	SMART
PLEC	1695	1729	1.3e-1	SMART
PLEC	1731	1767	1.4e-4	SMART
PLEC	1768	1805	2e-12	SMART
PLEC	1808	1843	5.2e-4	SMART
PLEC	1844	1881	4e-2	SMART
PLEC	1884	1919	1.9e0	SMART
low complexity region	1986	1997	N/A	INTRINSIC
low complexity region	2219	2228	N/A	INTRINSIC
PLEC	2275	2312	4.5e-6	SMART
PLEC	2347	2388	1.7e-7	SMART
PLEC	2389	2426	1.2e-5	SMART
PLEC	2447	2484	6.3e-3	SMART
PLEC	2485	2522	2.1e-4	SMART
PLEC	2523	2561	1.5e-1	SMART
PLEC	2586	2633	3.1e-1	SMART
PLEC	2671	2708	6.5e-10	SMART
PLEC	2709	2746	2.3e-3	SMART
low complexity region	2940	2950	N/A	INTRINSIC
coiled coil region	3355	3388	N/A	INTRINSIC
low complexity region	3419	3429	N/A	INTRINSIC
low complexity region	3555	3576	N/A	INTRINSIC
SPEC	3577	3683	7.1e-3	SMART
SPEC	3841	3951	2.6e-11	SMART
SPEC	3958	4064	1.1e-11	SMART
SPEC	4071	4173	3.6e-5	SMART
SPEC	4180	4279	2.9e-2	SMART
SPEC	4286	4417	2.2e-3	SMART
SPEC	4424	4529	8.2e-10	SMART
SPEC	4536	4640	7.4e-5	SMART
SPEC	4647	4750	1.7e-3	SMART
SPEC	4757	4860	3.2e-16	SMART
SPEC	4867	4967	1.2e-7	SMART
SPEC	4974	5080	1.8e-2	SMART
SPEC	5083	5185	1.3e-6	SMART
SPEC	5192	5296	2e-10	SMART
SPEC	5303	5405	2.8e-18	SMART
SPEC	5412	5514	7.7e-13	SMART
SPEC	5521	5623	1.5e-5	SMART
SPEC	5630	5732	2.7e-6	SMART
SPEC	5739	5840	6.1e-16	SMART
SPEC	5847	5953	3.6e-4	SMART
SPEC	5960	6062	4.1e-16	SMART
SPEC	6069	6172	2.4e-19	SMART
SPEC	6179	6281	7.6e-26	SMART
SPEC	6288	6391	2.2e-17	SMART
SPEC	6398	6500	1.6e-19	SMART
SPEC	6507	6610	5.7e-21	SMART
SPEC	6617	6718	1.5e-24	SMART
SPEC	6725	6827	3.2e-16	SMART
SPEC	6834	6964	9.4e-13	SMART
EFh	7002	7030	2.4e-5	SMART
EFh	7038	7066	5.8e-5	SMART
GAS2	7077	7155	5.5e-56	SMART
low complexity region	7177	7222	N/A	INTRINSIC
low complexity region	7271	7296	N/A	INTRINSIC
low complexity region	7313	7325	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000097897

SMART Domains

Protein: ENSMUSP00000095507
Gene: ENSMUSG00000028649

Domain	Start	End	E-Value	Type
low complexity region	6	35	N/A	INTRINSIC
low complexity region	65	79	N/A	INTRINSIC
CH	80	179	5.63e-28	SMART
CH	196	293	7.49e-24	SMART
SPEC	317	420	4.11e0	SMART
SPEC	583	680	4.32e-9	SMART
SPEC	683	783	5.75e-5	SMART
Blast:SPEC	790	955	4e-82	BLAST
coiled coil region	1046	1067	N/A	INTRINSIC
SPEC	1278	1407	2.35e0	SMART
SPEC	1425	1533	1.12e-7	SMART
PLEC	1530	1576	8.58e-4	SMART
PLEC	1577	1614	1.9e0	SMART
PLEC	1616	1653	1.38e1	SMART
PLEC	1654	1691	1.3e1	SMART
PLEC	1695	1729	2.1e1	SMART
PLEC	1731	1767	2.23e-2	SMART
PLEC	1768	1805	3.32e-10	SMART
PLEC	1808	1843	8.32e-2	SMART
PLEC	1844	1881	6.42e0	SMART
PLEC	1884	1919	3e2	SMART
low complexity region	1986	1997	N/A	INTRINSIC
low complexity region	2219	2228	N/A	INTRINSIC
PLEC	2275	2312	6.97e-4	SMART
PLEC	2347	2388	2.68e-5	SMART
PLEC	2389	2426	1.84e-3	SMART
PLEC	2447	2484	1.01e0	SMART
PLEC	2485	2522	3.38e-2	SMART
PLEC	2523	2561	2.39e1	SMART
PLEC	2586	2633	4.99e1	SMART
PLEC	2671	2708	1.05e-7	SMART
PLEC	2709	2746	3.57e-1	SMART
low complexity region	2940	2950	N/A	INTRINSIC
coiled coil region	3355	3388	N/A	INTRINSIC
low complexity region	3419	3429	N/A	INTRINSIC
low complexity region	3555	3576	N/A	INTRINSIC
SPEC	3577	3685	3.94e-3	SMART
SPEC	3845	3955	4.03e-9	SMART
SPEC	3962	4068	1.75e-9	SMART
SPEC	4075	4177	5.57e-3	SMART
SPEC	4184	4283	4.56e0	SMART
SPEC	4290	4421	3.46e-1	SMART
SPEC	4428	4533	1.29e-7	SMART
SPEC	4540	4644	1.19e-2	SMART
SPEC	4651	4754	2.7e-1	SMART
SPEC	4761	4864	4.99e-14	SMART
SPEC	4871	4971	1.9e-5	SMART
SPEC	4978	5084	2.83e0	SMART
SPEC	5087	5189	2.14e-4	SMART
SPEC	5196	5300	3.01e-8	SMART
SPEC	5307	5409	4.48e-16	SMART
SPEC	5416	5518	1.26e-10	SMART
SPEC	5525	5627	2.26e-3	SMART
SPEC	5634	5736	4.29e-4	SMART
SPEC	5743	5844	9.99e-14	SMART
SPEC	5851	5957	5.79e-2	SMART
SPEC	5964	6066	6.59e-14	SMART
SPEC	6073	6176	3.7e-17	SMART
SPEC	6183	6285	1.16e-23	SMART
SPEC	6292	6395	3.58e-15	SMART
SPEC	6402	6504	2.61e-17	SMART
SPEC	6511	6614	9.38e-19	SMART
SPEC	6621	6722	2.29e-22	SMART
SPEC	6729	6831	4.99e-14	SMART
SPEC	6838	6968	1.45e-10	SMART
EFh	7006	7034	5.08e-3	SMART
EFh	7042	7070	1.17e-2	SMART
GAS2	7081	7159	8.5e-54	SMART
low complexity region	7181	7226	N/A	INTRINSIC
low complexity region	7275	7300	N/A	INTRINSIC
low complexity region	7317	7329	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000106213

SMART Domains

Protein: ENSMUSP00000101819
Gene: ENSMUSG00000028649

Domain	Start	End	E-Value	Type
PLEC	12	49	1.9e0	SMART
PLEC	51	88	1.38e1	SMART
PLEC	89	126	1.3e1	SMART
PLEC	130	164	2.1e1	SMART
PLEC	166	202	2.23e-2	SMART
PLEC	203	240	3.32e-10	SMART
PLEC	243	278	8.32e-2	SMART
PLEC	279	316	6.42e0	SMART
PLEC	319	354	3e2	SMART
low complexity region	421	432	N/A	INTRINSIC
low complexity region	654	663	N/A	INTRINSIC
PLEC	710	747	6.97e-4	SMART
PLEC	782	823	2.68e-5	SMART
PLEC	824	861	1.84e-3	SMART
PLEC	882	919	1.01e0	SMART
PLEC	920	957	3.38e-2	SMART
PLEC	958	996	2.39e1	SMART
PLEC	1021	1068	4.99e1	SMART
PLEC	1106	1143	1.05e-7	SMART
PLEC	1144	1181	3.57e-1	SMART
low complexity region	1375	1385	N/A	INTRINSIC
coiled coil region	1790	1823	N/A	INTRINSIC
low complexity region	1854	1864	N/A	INTRINSIC
low complexity region	1990	2011	N/A	INTRINSIC
SPEC	2012	2120	3.94e-3	SMART
SPEC	2280	2390	4.03e-9	SMART
SPEC	2397	2503	1.75e-9	SMART
SPEC	2510	2612	5.57e-3	SMART
SPEC	2619	2718	4.56e0	SMART
SPEC	2725	2856	3.46e-1	SMART
SPEC	2863	2968	1.29e-7	SMART
SPEC	2975	3079	1.19e-2	SMART
SPEC	3086	3189	2.7e-1	SMART
SPEC	3196	3299	4.99e-14	SMART
SPEC	3306	3406	1.9e-5	SMART
SPEC	3413	3519	2.83e0	SMART
SPEC	3522	3624	2.14e-4	SMART
SPEC	3631	3735	3.01e-8	SMART
SPEC	3742	3844	4.48e-16	SMART
SPEC	3851	3953	4.15e-11	SMART
SPEC	3960	4062	7.07e-5	SMART
SPEC	4069	4171	2.26e-3	SMART
SPEC	4178	4280	4.29e-4	SMART
SPEC	4287	4388	9.99e-14	SMART
SPEC	4395	4501	5.79e-2	SMART
SPEC	4508	4610	6.59e-14	SMART
SPEC	4617	4720	3.7e-17	SMART
SPEC	4727	4829	1.16e-23	SMART
SPEC	4836	4939	3.58e-15	SMART
SPEC	4946	5048	2.61e-17	SMART
SPEC	5055	5158	9.38e-19	SMART
SPEC	5165	5266	2.29e-22	SMART
SPEC	5273	5375	4.99e-14	SMART
SPEC	5382	5512	1.45e-10	SMART
EFh	5546	5574	5.08e-3	SMART
EFh	5582	5610	1.17e-2	SMART
GAS2	5621	5699	8.5e-54	SMART
low complexity region	5721	5766	N/A	INTRINSIC
low complexity region	5815	5840	N/A	INTRINSIC
low complexity region	5857	5869	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000106220

SMART Domains

Protein: ENSMUSP00000101827
Gene: ENSMUSG00000028649

Domain	Start	End	E-Value	Type
CH	347	444	7.49e-24	SMART
SPEC	468	571	4.11e0	SMART
SPEC	734	831	4.32e-9	SMART
SPEC	834	934	5.75e-5	SMART
Blast:SPEC	941	1106	5e-82	BLAST
coiled coil region	1197	1218	N/A	INTRINSIC
SPEC	1429	1558	2.35e0	SMART
SPEC	1576	1684	1.12e-7	SMART
SPEC	1701	1809	1.85e-1	SMART
SPEC	1968	2078	4.03e-9	SMART
SPEC	2085	2191	1.75e-9	SMART
SPEC	2198	2300	5.57e-3	SMART
SPEC	2307	2406	4.56e0	SMART
SPEC	2413	2544	3.46e-1	SMART
SPEC	2551	2656	1.29e-7	SMART
SPEC	2663	2767	1.19e-2	SMART
SPEC	2774	2877	2.7e-1	SMART
SPEC	2884	2987	4.99e-14	SMART
SPEC	2994	3094	1.9e-5	SMART
SPEC	3101	3207	2.83e0	SMART
SPEC	3210	3312	2.14e-4	SMART
SPEC	3319	3423	3.01e-8	SMART
SPEC	3430	3532	4.48e-16	SMART
SPEC	3539	3641	1.26e-10	SMART
SPEC	3648	3750	2.26e-3	SMART
SPEC	3757	3859	4.29e-4	SMART
SPEC	3866	3967	9.99e-14	SMART
SPEC	3974	4080	5.79e-2	SMART
SPEC	4087	4189	6.59e-14	SMART
SPEC	4196	4299	3.7e-17	SMART
SPEC	4306	4408	1.16e-23	SMART
SPEC	4415	4518	3.58e-15	SMART
SPEC	4525	4627	2.61e-17	SMART
SPEC	4634	4737	9.38e-19	SMART
SPEC	4744	4845	2.29e-22	SMART
SPEC	4852	4954	4.99e-14	SMART
SPEC	4961	5091	1.45e-10	SMART
EFh	5129	5157	5.08e-3	SMART
EFh	5165	5193	1.17e-2	SMART
GAS2	5204	5282	1.59e-53	SMART
low complexity region	5304	5349	N/A	INTRINSIC
low complexity region	5398	5423	N/A	INTRINSIC
low complexity region	5440	5452	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000106224

SMART Domains

Protein: ENSMUSP00000101831
Gene: ENSMUSG00000028649

Domain	Start	End	E-Value	Type
low complexity region	6	35	N/A	INTRINSIC
low complexity region	65	79	N/A	INTRINSIC
CH	80	179	5.63e-28	SMART
CH	196	293	7.49e-24	SMART
SPEC	317	420	4.11e0	SMART
SPEC	583	680	4.32e-9	SMART
SPEC	683	783	5.75e-5	SMART
Blast:SPEC	790	955	5e-82	BLAST
coiled coil region	1046	1067	N/A	INTRINSIC
SPEC	1278	1407	2.35e0	SMART
SPEC	1425	1533	1.12e-7	SMART
PLEC	1530	1576	8.58e-4	SMART
PLEC	1577	1614	1.9e0	SMART
PLEC	1616	1653	1.38e1	SMART
PLEC	1654	1691	1.3e1	SMART
PLEC	1695	1729	2.1e1	SMART
PLEC	1731	1767	2.23e-2	SMART
PLEC	1768	1805	3.32e-10	SMART
PLEC	1808	1843	8.32e-2	SMART
PLEC	1844	1881	6.42e0	SMART
PLEC	1884	1919	3e2	SMART
low complexity region	1986	1997	N/A	INTRINSIC
low complexity region	2219	2228	N/A	INTRINSIC
PLEC	2275	2312	6.97e-4	SMART
PLEC	2347	2388	2.68e-5	SMART
PLEC	2389	2426	1.84e-3	SMART
PLEC	2447	2484	1.01e0	SMART
PLEC	2485	2522	3.38e-2	SMART
PLEC	2523	2561	2.39e1	SMART
PLEC	2586	2633	4.99e1	SMART
PLEC	2671	2708	1.05e-7	SMART
PLEC	2709	2746	3.57e-1	SMART
low complexity region	2940	2950	N/A	INTRINSIC
coiled coil region	3355	3388	N/A	INTRINSIC
low complexity region	3419	3429	N/A	INTRINSIC
low complexity region	3555	3576	N/A	INTRINSIC
SPEC	3577	3685	3.94e-3	SMART
SPEC	3845	3955	4.03e-9	SMART
SPEC	3962	4068	1.75e-9	SMART
SPEC	4075	4177	5.57e-3	SMART
SPEC	4184	4283	4.56e0	SMART
SPEC	4290	4421	3.46e-1	SMART
SPEC	4428	4533	1.29e-7	SMART
SPEC	4540	4642	9.34e-2	SMART
SPEC	4649	4752	2.7e-1	SMART
SPEC	4759	4862	4.99e-14	SMART
SPEC	4869	4969	1.9e-5	SMART
SPEC	4976	5082	2.83e0	SMART
SPEC	5085	5187	2.14e-4	SMART
SPEC	5194	5298	3.01e-8	SMART
SPEC	5305	5407	4.48e-16	SMART
SPEC	5414	5516	1.26e-10	SMART
SPEC	5523	5625	2.26e-3	SMART
SPEC	5632	5734	4.29e-4	SMART
SPEC	5741	5842	9.99e-14	SMART
SPEC	5849	5955	5.79e-2	SMART
SPEC	5962	6064	6.59e-14	SMART
SPEC	6071	6174	3.7e-17	SMART
SPEC	6181	6283	1.16e-23	SMART
SPEC	6290	6393	3.58e-15	SMART
SPEC	6400	6502	2.61e-17	SMART
SPEC	6509	6612	9.38e-19	SMART
SPEC	6619	6720	2.29e-22	SMART
SPEC	6727	6829	4.99e-14	SMART
SPEC	6836	6966	1.45e-10	SMART
EFh	7004	7032	5.08e-3	SMART
EFh	7040	7068	1.17e-2	SMART
GAS2	7079	7157	8.5e-54	SMART
low complexity region	7179	7224	N/A	INTRINSIC
low complexity region	7273	7298	N/A	INTRINSIC
low complexity region	7315	7327	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000125447

Predicted Effect

probably null
Transcript: ENSMUST00000134458

SMART Domains

Protein: ENSMUSP00000119885
Gene: ENSMUSG00000028649

Domain	Start	End	E-Value	Type
PDB:3R6N\|B	3	168	5e-37	PDB
coiled coil region	178	199	N/A	INTRINSIC
SPEC	410	539	2.35e0	SMART
SPEC	557	665	1.12e-7	SMART
SPEC	682	790	3.94e-3	SMART
SPEC	950	1060	4.03e-9	SMART
SPEC	1067	1173	1.75e-9	SMART
SPEC	1180	1282	5.57e-3	SMART
SPEC	1289	1388	4.56e0	SMART
SPEC	1395	1505	3.18e-1	SMART
SPEC	1512	1617	1.29e-7	SMART
SPEC	1624	1728	1.19e-2	SMART
SPEC	1735	1838	2.7e-1	SMART
SPEC	1845	1948	4.99e-14	SMART
SPEC	1955	2055	1.9e-5	SMART
SPEC	2062	2168	2.83e0	SMART
SPEC	2171	2273	2.14e-4	SMART
SPEC	2280	2384	3.01e-8	SMART
SPEC	2391	2493	4.48e-16	SMART
SPEC	2500	2602	1.26e-10	SMART
SPEC	2609	2711	2.26e-3	SMART
SPEC	2718	2820	4.29e-4	SMART
SPEC	2827	2928	9.99e-14	SMART
SPEC	2935	3041	5.79e-2	SMART
SPEC	3048	3150	6.59e-14	SMART
SPEC	3157	3260	3.7e-17	SMART
SPEC	3267	3369	1.16e-23	SMART
SPEC	3376	3479	3.58e-15	SMART
SPEC	3486	3588	2.61e-17	SMART
SPEC	3595	3698	9.38e-19	SMART
SPEC	3705	3806	2.29e-22	SMART
SPEC	3813	3915	4.99e-14	SMART
SPEC	3922	4052	1.45e-10	SMART
EFh	4086	4114	5.08e-3	SMART
EFh	4122	4150	1.17e-2	SMART
GAS2	4161	4233	2.28e-54	SMART
low complexity region	4255	4300	N/A	INTRINSIC
low complexity region	4349	4374	N/A	INTRINSIC
low complexity region	4391	4403	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000151346

SMART Domains

Protein: ENSMUSP00000114568
Gene: ENSMUSG00000028649

Domain	Start	End	E-Value	Type
CH	4	85	4.88e-14	SMART
CH	102	199	7.49e-24	SMART
SPEC	223	326	4.11e0	SMART
SPEC	489	586	4.32e-9	SMART
SPEC	589	689	5.75e-5	SMART
Blast:SPEC	696	861	3e-82	BLAST
coiled coil region	952	973	N/A	INTRINSIC
SPEC	1184	1313	2.35e0	SMART
SPEC	1331	1439	1.12e-7	SMART
SPEC	1456	1564	3.94e-3	SMART
SPEC	1724	1834	4.03e-9	SMART
SPEC	1841	1947	1.75e-9	SMART
SPEC	1954	2056	5.57e-3	SMART
SPEC	2063	2162	4.56e0	SMART
SPEC	2169	2300	3.46e-1	SMART
SPEC	2307	2412	1.29e-7	SMART
SPEC	2419	2523	1.19e-2	SMART
SPEC	2530	2633	2.7e-1	SMART
SPEC	2640	2743	4.99e-14	SMART
SPEC	2750	2850	1.9e-5	SMART
SPEC	2857	2963	2.83e0	SMART
SPEC	2966	3068	2.14e-4	SMART
SPEC	3075	3179	3.01e-8	SMART
SPEC	3186	3288	4.48e-16	SMART
SPEC	3295	3397	4.15e-11	SMART
SPEC	3404	3506	7.07e-5	SMART
SPEC	3513	3615	2.26e-3	SMART
SPEC	3622	3724	4.29e-4	SMART
SPEC	3731	3832	9.99e-14	SMART
SPEC	3839	3945	5.79e-2	SMART
SPEC	3952	4054	6.59e-14	SMART
SPEC	4061	4164	3.7e-17	SMART
SPEC	4171	4273	1.16e-23	SMART
SPEC	4280	4383	3.58e-15	SMART
SPEC	4390	4492	2.61e-17	SMART
SPEC	4499	4602	9.38e-19	SMART
SPEC	4609	4710	2.29e-22	SMART
SPEC	4717	4819	4.99e-14	SMART
SPEC	4826	4956	1.45e-10	SMART
EFh	4990	5018	5.08e-3	SMART
EFh	5026	5054	1.17e-2	SMART
GAS2	5065	5137	2.28e-54	SMART
low complexity region	5159	5204	N/A	INTRINSIC
low complexity region	5253	5278	N/A	INTRINSIC
low complexity region	5295	5307	N/A	INTRINSIC

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.6%
20x: 92.6%

Validation Efficiency

MGI Phenotype

Strain: 3652899; 4831019
Lethality: E7-E8
PHENOTYPE: Mice homozygous for a null allele exhibit lethality before somitogenesis with failure of the primitive streak to form. Mice heterozygous for a knock-out and floxed allele activated in neurons exhibit impaired cortical neuron migration, respiratory distress, and early postnatal lethality. [provided by MGI curators]

Allele List at MGI

All alleles(784) : Targeted(4) Gene trapped(780)

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9130019O22Rik	T	C	7: 127,385,042		probably benign	Het
Acacb	G	A	5: 114,228,591	E1565K	probably damaging	Het
Amy1	T	C	3: 113,569,509	N63S	probably damaging	Het
Arhgef15	G	T	11: 68,947,796	N591K	probably damaging	Het
AW551984	A	G	9: 39,600,614	S34P	probably damaging	Het
C2cd3	A	G	7: 100,432,091	D127G	probably damaging	Het
Ccdc87	T	A	19: 4,841,235	V585E	probably benign	Het
Cul2	T	C	18: 3,421,345	I223T	probably damaging	Het
Dgkq	C	T	5: 108,653,708	V495M	probably damaging	Het
Dpp10	A	G	1: 123,367,601	I570T	possibly damaging	Het
Dstyk	C	T	1: 132,449,804	Q383*	probably null	Het
Emilin2	C	A	17: 71,310,956		probably benign	Het
Fnip1	A	G	11: 54,515,567	I1163M	probably damaging	Het
Fryl	C	T	5: 73,090,751	E1008K	possibly damaging	Het
Gm15448	A	T	7: 3,822,346	H432Q	possibly damaging	Het
Gm35315	A	T	5: 110,078,659	Y305N	possibly damaging	Het
Grhl3	T	A	4: 135,557,196	D195V	probably damaging	Het
Il33	T	C	19: 29,952,000	F41S	probably benign	Het
Il4	A	G	11: 53,613,909	S15P	possibly damaging	Het
Inf2	C	T	12: 112,604,256	P410S	probably benign	Het
Kalrn	T	A	16: 34,332,164	D349V	possibly damaging	Het
Krt4	A	G	15: 101,922,794	M224T	probably benign	Het
Lrp2	C	T	2: 69,461,287	S3516N	probably damaging	Het
Msr1	G	A	8: 39,615,817	P213S	probably damaging	Het
Nptx1	G	T	11: 119,544,721	C256*	probably null	Het
Nr1d1	T	C	11: 98,772,014	Y51C	probably damaging	Het
Olfr1205	G	A	2: 88,831,525	R136Q	probably benign	Het
Panx3	T	C	9: 37,661,165	D363G	probably damaging	Het
Prkag1	A	G	15: 98,814,523	F143L	probably damaging	Het
Ptger4	T	C	15: 5,242,997	K72R	possibly damaging	Het
Pvrig	A	G	5: 138,342,050	T28A	probably benign	Het
Rhod	C	T	19: 4,426,105	C206Y	probably benign	Het
Rngtt	C	A	4: 33,320,606	S51*	probably null	Het
Rreb1	T	G	13: 37,932,129	S1155A	probably benign	Het
Scn9a	A	C	2: 66,526,963	I998S	possibly damaging	Het
Sfmbt1	T	A	14: 30,773,911	F50L	probably damaging	Het
Six4	A	T	12: 73,103,473	V766D	probably damaging	Het
Smpd1	T	C	7: 105,556,928	I421T	probably damaging	Het
Son	T	A	16: 91,658,166	M1267K	probably benign	Het
Styk1	T	A	6: 131,310,064	D156V	possibly damaging	Het
Supt3	A	G	17: 45,119,143	E361G	probably benign	Het
Tbx3	T	A	5: 119,674,191	Y185*	probably null	Het
Tmem2	T	C	19: 21,801,908	C361R	probably benign	Het
Trpm1	A	T	7: 64,268,504	T531S	probably benign	Het
Tspan32	T	A	7: 143,018,742	W172R	possibly damaging	Het
Ttc26	T	A	6: 38,398,313	S250T	possibly damaging	Het
Urb1	A	T	16: 90,762,430		probably null	Het
Vmn2r70	T	A	7: 85,559,068	I734F	probably damaging	Het
Vwa7	A	G	17: 35,024,199	T618A	probably benign	Het
Wac	T	A	18: 7,920,163	V339E	probably damaging	Het
Wrn	G	A	8: 33,342,996	T156M	probably damaging	Het
Zeb1	T	A	18: 5,770,498	C884S	probably damaging	Het
Zmpste24	A	G	4: 121,095,670	V10A	probably damaging	Het

Other mutations in Macf1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00983:Macf1	APN	4	123,382,122 (GRCm38)	missense	probably damaging	0.99
IGL01293:Macf1	APN	4	123,471,311 (GRCm38)	missense	probably benign	0.00
IGL01307:Macf1	APN	4	123,383,129 (GRCm38)	missense	probably damaging	1.00
IGL01314:Macf1	APN	4	123,486,720 (GRCm38)	missense	probably damaging	1.00
IGL01321:Macf1	APN	4	123,440,774 (GRCm38)	missense	probably damaging	1.00
IGL01327:Macf1	APN	4	123,509,912 (GRCm38)	missense	probably benign	0.20
IGL01365:Macf1	APN	4	123,391,169 (GRCm38)	missense	probably damaging	1.00
IGL01465:Macf1	APN	4	123,490,721 (GRCm38)	missense	probably benign	0.00
IGL01527:Macf1	APN	4	123,493,160 (GRCm38)	missense	possibly damaging	0.93
IGL01533:Macf1	APN	4	123,473,873 (GRCm38)	missense	probably damaging	1.00
IGL01539:Macf1	APN	4	123,395,908 (GRCm38)	splice site	probably benign
IGL01543:Macf1	APN	4	123,401,457 (GRCm38)	missense	probably damaging	1.00
IGL01553:Macf1	APN	4	123,493,163 (GRCm38)	nonsense	probably null
IGL01558:Macf1	APN	4	123,453,005 (GRCm38)	missense	probably benign	0.00
IGL01633:Macf1	APN	4	123,502,171 (GRCm38)	missense	probably damaging	0.99
IGL01684:Macf1	APN	4	123,465,930 (GRCm38)	missense	probably damaging	1.00
IGL01715:Macf1	APN	4	123,391,086 (GRCm38)	missense	probably damaging	1.00
IGL01844:Macf1	APN	4	123,440,692 (GRCm38)	missense	probably benign	0.34
IGL01870:Macf1	APN	4	123,474,113 (GRCm38)	missense	probably damaging	0.99
IGL01916:Macf1	APN	4	123,441,630 (GRCm38)	missense	probably damaging	1.00
IGL01916:Macf1	APN	4	123,476,037 (GRCm38)	missense	probably damaging	1.00
IGL01923:Macf1	APN	4	123,380,444 (GRCm38)	missense	possibly damaging	0.46
IGL02017:Macf1	APN	4	123,499,931 (GRCm38)	missense	probably damaging	1.00
IGL02022:Macf1	APN	4	123,391,049 (GRCm38)	critical splice donor site	probably null
IGL02084:Macf1	APN	4	123,432,603 (GRCm38)	missense	probably benign	0.02
IGL02084:Macf1	APN	4	123,459,374 (GRCm38)	missense	probably damaging	1.00
IGL02142:Macf1	APN	4	123,472,049 (GRCm38)	missense	probably benign	0.11
IGL02151:Macf1	APN	4	123,371,766 (GRCm38)	splice site	probably benign
IGL02164:Macf1	APN	4	123,480,272 (GRCm38)	missense	probably benign	0.03
IGL02174:Macf1	APN	4	123,491,794 (GRCm38)	missense	probably damaging	1.00
IGL02229:Macf1	APN	4	123,509,826 (GRCm38)	missense	probably damaging	1.00
IGL02277:Macf1	APN	4	123,486,704 (GRCm38)	missense	probably damaging	1.00
IGL02283:Macf1	APN	4	123,471,375 (GRCm38)	missense	probably benign	0.01
IGL02314:Macf1	APN	4	123,444,837 (GRCm38)	missense	probably damaging	0.99
IGL02327:Macf1	APN	4	123,471,730 (GRCm38)	missense	probably benign	0.06
IGL02348:Macf1	APN	4	123,512,866 (GRCm38)	missense	probably damaging	1.00
IGL02441:Macf1	APN	4	123,387,236 (GRCm38)	missense	probably damaging	1.00
IGL02585:Macf1	APN	4	123,472,284 (GRCm38)	missense	probably benign	0.00
IGL02602:Macf1	APN	4	123,355,163 (GRCm38)	missense	probably damaging	1.00
IGL03204:Macf1	APN	4	123,355,277 (GRCm38)	splice site	probably benign
anakex	UTSW	4	123,408,271 (GRCm38)	missense	probably damaging	0.97
esfuerzo	UTSW	4	123,476,129 (GRCm38)	missense	probably benign	0.22
Royal_flush	UTSW	4	123,365,355 (GRCm38)	splice site	probably null
standard	UTSW	4	123,486,406 (GRCm38)	missense	probably damaging	1.00
suspension	UTSW	4	123,497,755 (GRCm38)	missense	probably damaging	1.00
voragine	UTSW	4	123,355,102 (GRCm38)	missense	probably damaging	1.00
BB010:Macf1	UTSW	4	123,409,651 (GRCm38)	missense	probably benign	0.00
BB020:Macf1	UTSW	4	123,409,651 (GRCm38)	missense	probably benign	0.00
H8562:Macf1	UTSW	4	123,466,040 (GRCm38)	missense	probably benign	0.13
IGL03052:Macf1	UTSW	4	123,387,395 (GRCm38)	missense	probably damaging	1.00
N/A - 535:Macf1	UTSW	4	123,473,808 (GRCm38)	missense	possibly damaging	0.82
PIT4576001:Macf1	UTSW	4	123,473,321 (GRCm38)	missense	probably benign	0.43
R0021:Macf1	UTSW	4	123,475,577 (GRCm38)	missense	probably damaging	1.00
R0023:Macf1	UTSW	4	123,488,314 (GRCm38)	splice site	probably benign
R0023:Macf1	UTSW	4	123,488,314 (GRCm38)	splice site	probably benign
R0028:Macf1	UTSW	4	123,382,102 (GRCm38)	missense	probably damaging	1.00
R0066:Macf1	UTSW	4	123,432,150 (GRCm38)	nonsense	probably null
R0066:Macf1	UTSW	4	123,432,150 (GRCm38)	nonsense	probably null
R0067:Macf1	UTSW	4	123,475,248 (GRCm38)	missense	possibly damaging	0.90
R0067:Macf1	UTSW	4	123,475,248 (GRCm38)	missense	possibly damaging	0.90
R0078:Macf1	UTSW	4	123,473,868 (GRCm38)	missense	probably damaging	1.00
R0106:Macf1	UTSW	4	123,408,564 (GRCm38)	missense	probably benign	0.00
R0123:Macf1	UTSW	4	123,432,843 (GRCm38)	missense	possibly damaging	0.78
R0129:Macf1	UTSW	4	123,433,275 (GRCm38)	missense	probably damaging	1.00
R0134:Macf1	UTSW	4	123,432,843 (GRCm38)	missense	possibly damaging	0.78
R0138:Macf1	UTSW	4	123,440,747 (GRCm38)	missense	probably damaging	1.00
R0145:Macf1	UTSW	4	123,387,397 (GRCm38)	missense	probably damaging	1.00
R0195:Macf1	UTSW	4	123,434,916 (GRCm38)	missense	probably damaging	0.99
R0227:Macf1	UTSW	4	123,399,391 (GRCm38)	missense	probably benign	0.14
R0233:Macf1	UTSW	4	123,450,127 (GRCm38)	splice site	probably benign
R0254:Macf1	UTSW	4	123,432,779 (GRCm38)	missense	probably damaging	1.00
R0357:Macf1	UTSW	4	123,457,983 (GRCm38)	missense	probably damaging	1.00
R0398:Macf1	UTSW	4	123,351,017 (GRCm38)	missense	probably damaging	1.00
R0413:Macf1	UTSW	4	123,472,269 (GRCm38)	missense	probably benign
R0426:Macf1	UTSW	4	123,483,660 (GRCm38)	nonsense	probably null
R0441:Macf1	UTSW	4	123,365,355 (GRCm38)	splice site	probably null
R0453:Macf1	UTSW	4	123,444,944 (GRCm38)	missense	probably benign	0.35
R0481:Macf1	UTSW	4	123,484,022 (GRCm38)	splice site	probably null
R0502:Macf1	UTSW	4	123,469,815 (GRCm38)	missense	probably damaging	1.00
R0503:Macf1	UTSW	4	123,469,815 (GRCm38)	missense	probably damaging	1.00
R0519:Macf1	UTSW	4	123,471,320 (GRCm38)	missense	probably benign	0.03
R0543:Macf1	UTSW	4	123,376,378 (GRCm38)	missense	probably damaging	1.00
R0621:Macf1	UTSW	4	123,380,534 (GRCm38)	missense	probably damaging	1.00
R0631:Macf1	UTSW	4	123,455,524 (GRCm38)	nonsense	probably null
R0720:Macf1	UTSW	4	123,432,925 (GRCm38)	missense	probably damaging	1.00
R0730:Macf1	UTSW	4	123,382,530 (GRCm38)	splice site	probably benign
R0755:Macf1	UTSW	4	123,369,926 (GRCm38)	missense	probably damaging	0.99
R0836:Macf1	UTSW	4	123,494,882 (GRCm38)	critical splice donor site	probably null
R0847:Macf1	UTSW	4	123,399,366 (GRCm38)	missense	probably benign	0.03
R0850:Macf1	UTSW	4	123,474,402 (GRCm38)	missense	probably benign
R0924:Macf1	UTSW	4	123,385,478 (GRCm38)	missense	probably damaging	1.00
R0973:Macf1	UTSW	4	123,476,000 (GRCm38)	missense	possibly damaging	0.76
R1025:Macf1	UTSW	4	123,473,816 (GRCm38)	missense	probably damaging	1.00
R1076:Macf1	UTSW	4	123,385,598 (GRCm38)	missense	probably damaging	1.00
R1253:Macf1	UTSW	4	123,457,967 (GRCm38)	missense	probably damaging	1.00
R1301:Macf1	UTSW	4	123,486,658 (GRCm38)	splice site	probably benign
R1337:Macf1	UTSW	4	123,476,275 (GRCm38)	missense	probably benign	0.34
R1344:Macf1	UTSW	4	123,433,453 (GRCm38)	missense	probably damaging	0.99
R1404:Macf1	UTSW	4	123,376,516 (GRCm38)	missense	probably damaging	1.00
R1404:Macf1	UTSW	4	123,376,516 (GRCm38)	missense	probably damaging	1.00
R1443:Macf1	UTSW	4	123,511,007 (GRCm38)	missense	probably damaging	1.00
R1452:Macf1	UTSW	4	123,493,998 (GRCm38)	missense	probably benign
R1465:Macf1	UTSW	4	123,493,154 (GRCm38)	missense	probably damaging	0.98
R1465:Macf1	UTSW	4	123,493,154 (GRCm38)	missense	probably damaging	0.98
R1483:Macf1	UTSW	4	123,510,977 (GRCm38)	missense	probably damaging	1.00
R1509:Macf1	UTSW	4	123,684,009 (GRCm38)	missense	possibly damaging	0.92
R1510:Macf1	UTSW	4	123,434,762 (GRCm38)	missense	probably null	1.00
R1515:Macf1	UTSW	4	123,378,480 (GRCm38)	missense	probably damaging	1.00
R1524:Macf1	UTSW	4	123,432,530 (GRCm38)	missense	possibly damaging	0.75
R1528:Macf1	UTSW	4	123,476,014 (GRCm38)	missense	probably benign	0.30
R1535:Macf1	UTSW	4	123,440,693 (GRCm38)	missense	probably benign	0.05
R1556:Macf1	UTSW	4	123,455,020 (GRCm38)	missense	probably damaging	1.00
R1564:Macf1	UTSW	4	123,459,357 (GRCm38)	missense	probably benign	0.00
R1586:Macf1	UTSW	4	123,509,846 (GRCm38)	missense	probably benign	0.20
R1626:Macf1	UTSW	4	123,471,534 (GRCm38)	missense	probably benign
R1629:Macf1	UTSW	4	123,508,415 (GRCm38)	nonsense	probably null
R1649:Macf1	UTSW	4	123,484,053 (GRCm38)	missense	probably damaging	0.96
R1650:Macf1	UTSW	4	123,456,600 (GRCm38)	nonsense	probably null
R1706:Macf1	UTSW	4	123,370,584 (GRCm38)	critical splice donor site	probably null
R1713:Macf1	UTSW	4	123,378,694 (GRCm38)	missense	probably damaging	1.00
R1716:Macf1	UTSW	4	123,401,403 (GRCm38)	missense	probably damaging	1.00
R1744:Macf1	UTSW	4	123,475,853 (GRCm38)	missense	probably damaging	1.00
R1752:Macf1	UTSW	4	123,483,672 (GRCm38)	missense	possibly damaging	0.92
R1771:Macf1	UTSW	4	123,512,108 (GRCm38)	missense	probably damaging	1.00
R1812:Macf1	UTSW	4	123,432,024 (GRCm38)	missense	probably damaging	1.00
R1818:Macf1	UTSW	4	123,376,417 (GRCm38)	missense	probably damaging	1.00
R1853:Macf1	UTSW	4	123,512,720 (GRCm38)	splice site	probably null
R1856:Macf1	UTSW	4	123,369,848 (GRCm38)	missense	probably damaging	1.00
R1869:Macf1	UTSW	4	123,351,128 (GRCm38)	missense	probably damaging	1.00
R1880:Macf1	UTSW	4	123,438,591 (GRCm38)	missense	probably damaging	1.00
R1888:Macf1	UTSW	4	123,474,712 (GRCm38)	missense	probably benign
R1888:Macf1	UTSW	4	123,474,712 (GRCm38)	missense	probably benign
R1888:Macf1	UTSW	4	123,455,042 (GRCm38)	missense	possibly damaging	0.91
R1888:Macf1	UTSW	4	123,455,042 (GRCm38)	missense	possibly damaging	0.91
R1902:Macf1	UTSW	4	123,471,165 (GRCm38)	missense	probably benign	0.01
R1907:Macf1	UTSW	4	123,372,399 (GRCm38)	missense	probably damaging	1.00
R1908:Macf1	UTSW	4	123,457,841 (GRCm38)	missense	possibly damaging	0.67
R1932:Macf1	UTSW	4	123,452,037 (GRCm38)	missense	probably damaging	1.00
R1944:Macf1	UTSW	4	123,370,666 (GRCm38)	missense	probably damaging	1.00
R1945:Macf1	UTSW	4	123,490,660 (GRCm38)	nonsense	probably null
R1975:Macf1	UTSW	4	123,489,212 (GRCm38)	missense	probably damaging	1.00
R1989:Macf1	UTSW	4	123,497,726 (GRCm38)	critical splice donor site	probably null
R1991:Macf1	UTSW	4	123,456,695 (GRCm38)	missense	probably damaging	1.00
R1992:Macf1	UTSW	4	123,456,695 (GRCm38)	missense	probably damaging	1.00
R2013:Macf1	UTSW	4	123,684,014 (GRCm38)	missense	probably damaging	1.00
R2021:Macf1	UTSW	4	123,472,730 (GRCm38)	missense	probably damaging	1.00
R2022:Macf1	UTSW	4	123,472,730 (GRCm38)	missense	probably damaging	1.00
R2023:Macf1	UTSW	4	123,472,730 (GRCm38)	missense	probably damaging	1.00
R2024:Macf1	UTSW	4	123,371,918 (GRCm38)	missense	probably damaging	1.00
R2025:Macf1	UTSW	4	123,371,918 (GRCm38)	missense	probably damaging	1.00
R2027:Macf1	UTSW	4	123,371,918 (GRCm38)	missense	probably damaging	1.00
R2049:Macf1	UTSW	4	123,355,102 (GRCm38)	missense	probably damaging	1.00
R2060:Macf1	UTSW	4	123,499,919 (GRCm38)	splice site	probably null
R2092:Macf1	UTSW	4	123,383,178 (GRCm38)	missense	probably damaging	1.00
R2100:Macf1	UTSW	4	123,397,906 (GRCm38)	nonsense	probably null
R2128:Macf1	UTSW	4	123,492,774 (GRCm38)	missense	probably benign	0.11
R2129:Macf1	UTSW	4	123,368,815 (GRCm38)	splice site	probably benign
R2140:Macf1	UTSW	4	123,355,102 (GRCm38)	missense	probably damaging	1.00
R2142:Macf1	UTSW	4	123,355,102 (GRCm38)	missense	probably damaging	1.00
R2182:Macf1	UTSW	4	123,492,671 (GRCm38)	missense	probably damaging	0.98
R2185:Macf1	UTSW	4	123,475,556 (GRCm38)	missense	probably damaging	0.99
R2190:Macf1	UTSW	4	123,459,212 (GRCm38)	missense	probably benign	0.11
R2320:Macf1	UTSW	4	123,439,495 (GRCm38)	missense	probably benign	0.02
R2382:Macf1	UTSW	4	123,374,832 (GRCm38)	missense	probably damaging	1.00
R2429:Macf1	UTSW	4	123,432,584 (GRCm38)	missense	probably damaging	0.99
R2432:Macf1	UTSW	4	123,683,996 (GRCm38)	missense	probably damaging	1.00
R2484:Macf1	UTSW	4	123,473,672 (GRCm38)	missense	probably damaging	1.00
R2842:Macf1	UTSW	4	123,376,417 (GRCm38)	missense	probably damaging	1.00
R2912:Macf1	UTSW	4	123,475,911 (GRCm38)	missense	probably damaging	1.00
R2913:Macf1	UTSW	4	123,475,911 (GRCm38)	missense	probably damaging	1.00
R2914:Macf1	UTSW	4	123,475,911 (GRCm38)	missense	probably damaging	1.00
R2938:Macf1	UTSW	4	123,432,902 (GRCm38)	missense	probably damaging	0.99
R3082:Macf1	UTSW	4	123,361,443 (GRCm38)	splice site	probably null
R3086:Macf1	UTSW	4	123,435,108 (GRCm38)	missense	probably benign	0.00
R3408:Macf1	UTSW	4	123,381,781 (GRCm38)	missense	probably damaging	1.00
R3499:Macf1	UTSW	4	123,527,305 (GRCm38)	nonsense	probably null
R3696:Macf1	UTSW	4	123,456,362 (GRCm38)	missense	probably damaging	1.00
R3716:Macf1	UTSW	4	123,473,502 (GRCm38)	missense	probably benign	0.01
R3727:Macf1	UTSW	4	123,459,311 (GRCm38)	missense	probably damaging	1.00
R3770:Macf1	UTSW	4	123,374,767 (GRCm38)	missense	probably damaging	1.00
R3813:Macf1	UTSW	4	123,374,767 (GRCm38)	missense	probably damaging	1.00
R3825:Macf1	UTSW	4	123,444,951 (GRCm38)	missense	probably benign	0.11
R3893:Macf1	UTSW	4	123,486,406 (GRCm38)	missense	probably damaging	1.00
R3896:Macf1	UTSW	4	123,471,194 (GRCm38)	missense	possibly damaging	0.55
R3947:Macf1	UTSW	4	123,380,420 (GRCm38)	missense	probably damaging	1.00
R4031:Macf1	UTSW	4	123,381,312 (GRCm38)	missense	probably damaging	1.00
R4052:Macf1	UTSW	4	123,472,017 (GRCm38)	missense	probably benign	0.00
R4077:Macf1	UTSW	4	123,472,091 (GRCm38)	missense	probably benign	0.07
R4078:Macf1	UTSW	4	123,472,091 (GRCm38)	missense	probably benign	0.07
R4084:Macf1	UTSW	4	123,450,072 (GRCm38)	missense	probably damaging	0.98
R4094:Macf1	UTSW	4	123,459,269 (GRCm38)	missense	probably benign	0.00
R4154:Macf1	UTSW	4	123,471,813 (GRCm38)	missense	probably damaging	1.00
R4190:Macf1	UTSW	4	123,473,042 (GRCm38)	missense	possibly damaging	0.95
R4191:Macf1	UTSW	4	123,473,042 (GRCm38)	missense	possibly damaging	0.95
R4192:Macf1	UTSW	4	123,473,042 (GRCm38)	missense	possibly damaging	0.95
R4232:Macf1	UTSW	4	123,432,392 (GRCm38)	missense	probably damaging	1.00
R4299:Macf1	UTSW	4	123,399,406 (GRCm38)	missense	probably damaging	1.00
R4326:Macf1	UTSW	4	123,382,212 (GRCm38)	missense	probably damaging	1.00
R4327:Macf1	UTSW	4	123,382,212 (GRCm38)	missense	probably damaging	1.00
R4355:Macf1	UTSW	4	123,475,091 (GRCm38)	missense	possibly damaging	0.79
R4380:Macf1	UTSW	4	123,354,492 (GRCm38)	intron	probably benign
R4422:Macf1	UTSW	4	123,466,046 (GRCm38)	missense	probably damaging	0.96
R4436:Macf1	UTSW	4	123,527,342 (GRCm38)	missense	probably benign	0.03
R4472:Macf1	UTSW	4	123,395,989 (GRCm38)	missense	probably damaging	1.00
R4515:Macf1	UTSW	4	123,493,988 (GRCm38)	missense	probably damaging	1.00
R4549:Macf1	UTSW	4	123,473,693 (GRCm38)	missense	possibly damaging	0.75
R4621:Macf1	UTSW	4	123,372,348 (GRCm38)	critical splice donor site	probably null
R4622:Macf1	UTSW	4	123,372,348 (GRCm38)	critical splice donor site	probably null
R4623:Macf1	UTSW	4	123,372,348 (GRCm38)	critical splice donor site	probably null
R4630:Macf1	UTSW	4	123,473,639 (GRCm38)	missense	possibly damaging	0.84
R4647:Macf1	UTSW	4	123,473,627 (GRCm38)	missense	probably benign	0.01
R4650:Macf1	UTSW	4	123,473,619 (GRCm38)	missense	probably benign	0.00
R4674:Macf1	UTSW	4	123,472,397 (GRCm38)	missense	probably benign	0.22
R4751:Macf1	UTSW	4	123,471,650 (GRCm38)	missense	probably benign	0.01
R4762:Macf1	UTSW	4	123,455,444 (GRCm38)	missense	probably benign	0.00
R4776:Macf1	UTSW	4	123,476,015 (GRCm38)	missense	probably benign	0.00
R4777:Macf1	UTSW	4	123,376,502 (GRCm38)	missense	probably damaging	1.00
R4860:Macf1	UTSW	4	123,486,750 (GRCm38)	missense	probably damaging	1.00
R4860:Macf1	UTSW	4	123,486,750 (GRCm38)	missense	probably damaging	1.00
R4865:Macf1	UTSW	4	123,433,303 (GRCm38)	missense	probably damaging	1.00
R4867:Macf1	UTSW	4	123,472,200 (GRCm38)	missense	probably damaging	0.97
R4884:Macf1	UTSW	4	123,455,009 (GRCm38)	missense	probably benign	0.02
R4890:Macf1	UTSW	4	123,448,238 (GRCm38)	missense	probably damaging	1.00
R4913:Macf1	UTSW	4	123,499,889 (GRCm38)	missense	probably damaging	1.00
R4925:Macf1	UTSW	4	123,526,652 (GRCm38)	missense	probably benign
R4948:Macf1	UTSW	4	123,497,755 (GRCm38)	missense	probably damaging	1.00
R4958:Macf1	UTSW	4	123,475,364 (GRCm38)	missense	probably damaging	0.99
R4986:Macf1	UTSW	4	123,391,121 (GRCm38)	missense	probably damaging	1.00
R4999:Macf1	UTSW	4	123,494,909 (GRCm38)	missense	probably benign	0.14
R5004:Macf1	UTSW	4	123,385,475 (GRCm38)	missense	probably damaging	1.00
R5017:Macf1	UTSW	4	123,452,113 (GRCm38)	missense	probably damaging	1.00
R5018:Macf1	UTSW	4	123,385,599 (GRCm38)	missense	probably damaging	1.00
R5026:Macf1	UTSW	4	123,439,494 (GRCm38)	missense	possibly damaging	0.95
R5037:Macf1	UTSW	4	123,455,519 (GRCm38)	missense	probably damaging	0.97
R5039:Macf1	UTSW	4	123,511,220 (GRCm38)	missense	probably damaging	1.00
R5041:Macf1	UTSW	4	123,397,046 (GRCm38)	splice site	probably null
R5100:Macf1	UTSW	4	123,474,468 (GRCm38)	missense	probably benign	0.11
R5110:Macf1	UTSW	4	123,368,008 (GRCm38)	missense	probably damaging	0.99
R5122:Macf1	UTSW	4	123,452,292 (GRCm38)	missense	probably damaging	1.00
R5187:Macf1	UTSW	4	123,472,089 (GRCm38)	missense	probably benign	0.00
R5191:Macf1	UTSW	4	123,472,962 (GRCm38)	missense	probably benign	0.00
R5201:Macf1	UTSW	4	123,475,945 (GRCm38)	nonsense	probably null
R5236:Macf1	UTSW	4	123,397,821 (GRCm38)	missense	probably damaging	1.00
R5248:Macf1	UTSW	4	123,401,774 (GRCm38)	nonsense	probably null
R5251:Macf1	UTSW	4	123,449,967 (GRCm38)	missense	probably benign	0.20
R5319:Macf1	UTSW	4	123,473,436 (GRCm38)	missense	probably damaging	1.00
R5326:Macf1	UTSW	4	123,350,991 (GRCm38)	frame shift	probably null
R5327:Macf1	UTSW	4	123,350,991 (GRCm38)	frame shift	probably null
R5328:Macf1	UTSW	4	123,350,991 (GRCm38)	frame shift	probably null
R5350:Macf1	UTSW	4	123,527,458 (GRCm38)	start codon destroyed	probably null	0.02
R5390:Macf1	UTSW	4	123,471,753 (GRCm38)	missense	probably damaging	0.98
R5419:Macf1	UTSW	4	123,397,124 (GRCm38)	missense	possibly damaging	0.70
R5428:Macf1	UTSW	4	123,384,868 (GRCm38)	missense	probably damaging	1.00
R5432:Macf1	UTSW	4	123,459,336 (GRCm38)	nonsense	probably null
R5466:Macf1	UTSW	4	123,452,865 (GRCm38)	missense	possibly damaging	0.75
R5472:Macf1	UTSW	4	123,450,061 (GRCm38)	missense	probably benign
R5564:Macf1	UTSW	4	123,526,745 (GRCm38)	missense	possibly damaging	0.92
R5566:Macf1	UTSW	4	123,435,164 (GRCm38)	missense	probably damaging	0.98
R5597:Macf1	UTSW	4	123,539,777 (GRCm38)	intron	probably benign
R5669:Macf1	UTSW	4	123,476,225 (GRCm38)	missense	probably damaging	1.00
R5682:Macf1	UTSW	4	123,434,759 (GRCm38)	missense	probably damaging	1.00
R5701:Macf1	UTSW	4	123,503,225 (GRCm38)	missense	probably damaging	1.00
R5715:Macf1	UTSW	4	123,684,014 (GRCm38)	missense	probably damaging	1.00
R5760:Macf1	UTSW	4	123,513,884 (GRCm38)	missense	probably damaging	1.00
R5806:Macf1	UTSW	4	123,371,887 (GRCm38)	missense	probably damaging	1.00
R5838:Macf1	UTSW	4	123,452,154 (GRCm38)	missense	possibly damaging	0.95
R5839:Macf1	UTSW	4	123,381,324 (GRCm38)	missense	probably damaging	1.00
R5850:Macf1	UTSW	4	123,507,306 (GRCm38)	missense	probably damaging	1.00
R5875:Macf1	UTSW	4	123,432,314 (GRCm38)	missense	possibly damaging	0.78
R5912:Macf1	UTSW	4	123,397,158 (GRCm38)	missense	probably damaging	1.00
R5913:Macf1	UTSW	4	123,476,039 (GRCm38)	missense	probably damaging	1.00
R5921:Macf1	UTSW	4	123,526,711 (GRCm38)	missense	probably benign
R5940:Macf1	UTSW	4	123,432,881 (GRCm38)	missense	probably damaging	1.00
R5950:Macf1	UTSW	4	123,439,436 (GRCm38)	splice site	probably null
R6005:Macf1	UTSW	4	123,474,275 (GRCm38)	missense	possibly damaging	0.82
R6029:Macf1	UTSW	4	123,507,333 (GRCm38)	missense	probably damaging	1.00
R6041:Macf1	UTSW	4	123,513,848 (GRCm38)	missense	probably damaging	1.00
R6057:Macf1	UTSW	4	123,510,743 (GRCm38)	missense	probably damaging	0.98
R6156:Macf1	UTSW	4	123,472,280 (GRCm38)	missense	probably benign	0.00
R6186:Macf1	UTSW	4	123,484,175 (GRCm38)	missense	probably damaging	1.00
R6197:Macf1	UTSW	4	123,452,292 (GRCm38)	missense	probably damaging	1.00
R6262:Macf1	UTSW	4	123,473,190 (GRCm38)	missense	possibly damaging	0.79
R6296:Macf1	UTSW	4	123,432,875 (GRCm38)	missense	probably damaging	1.00
R6340:Macf1	UTSW	4	123,448,249 (GRCm38)	missense	probably benign	0.13
R6369:Macf1	UTSW	4	123,410,562 (GRCm38)	missense	possibly damaging	0.90
R6414:Macf1	UTSW	4	123,493,195 (GRCm38)	missense	possibly damaging	0.93
R6501:Macf1	UTSW	4	123,469,632 (GRCm38)	splice site	probably null
R6508:Macf1	UTSW	4	123,469,742 (GRCm38)	missense	probably damaging	0.96
R6519:Macf1	UTSW	4	123,472,325 (GRCm38)	missense	probably benign	0.13
R6535:Macf1	UTSW	4	123,471,935 (GRCm38)	missense	possibly damaging	0.82
R6537:Macf1	UTSW	4	123,492,725 (GRCm38)	missense	probably damaging	1.00
R6546:Macf1	UTSW	4	123,432,281 (GRCm38)	missense	probably benign	0.14
R6583:Macf1	UTSW	4	123,470,946 (GRCm38)	splice site	probably null
R6597:Macf1	UTSW	4	123,382,692 (GRCm38)	missense	probably damaging	1.00
R6693:Macf1	UTSW	4	123,473,808 (GRCm38)	missense	possibly damaging	0.82
R6696:Macf1	UTSW	4	123,509,803 (GRCm38)	missense	probably damaging	1.00
R6704:Macf1	UTSW	4	123,410,762 (GRCm38)	intron	probably benign
R6716:Macf1	UTSW	4	123,508,438 (GRCm38)	missense	probably damaging	1.00
R6789:Macf1	UTSW	4	123,372,438 (GRCm38)	missense	probably damaging	1.00
R6807:Macf1	UTSW	4	123,374,415 (GRCm38)	missense	probably damaging	1.00
R6825:Macf1	UTSW	4	123,383,222 (GRCm38)	splice site	probably null
R6881:Macf1	UTSW	4	123,432,453 (GRCm38)	missense	probably damaging	1.00
R6894:Macf1	UTSW	4	123,483,687 (GRCm38)	missense	possibly damaging	0.89
R6924:Macf1	UTSW	4	123,527,352 (GRCm38)	missense	possibly damaging	0.53
R6962:Macf1	UTSW	4	123,440,722 (GRCm38)	missense	probably benign	0.01
R6965:Macf1	UTSW	4	123,408,745 (GRCm38)	missense	probably benign	0.38
R6969:Macf1	UTSW	4	123,457,800 (GRCm38)	missense	probably benign	0.01
R7032:Macf1	UTSW	4	123,472,308 (GRCm38)	missense	probably benign	0.00
R7055:Macf1	UTSW	4	123,409,196 (GRCm38)	missense	probably benign	0.01
R7078:Macf1	UTSW	4	123,432,143 (GRCm38)	missense	probably damaging	0.99
R7215:Macf1	UTSW	4	123,507,304 (GRCm38)	missense	probably damaging	1.00
R7263:Macf1	UTSW	4	123,378,150 (GRCm38)	missense	probably damaging	1.00
R7265:Macf1	UTSW	4	123,407,877 (GRCm38)	missense	probably benign	0.00
R7278:Macf1	UTSW	4	123,440,743 (GRCm38)	missense	possibly damaging	0.87
R7312:Macf1	UTSW	4	123,506,337 (GRCm38)	missense	probably damaging	1.00
R7324:Macf1	UTSW	4	123,374,425 (GRCm38)	missense	probably benign	0.09
R7334:Macf1	UTSW	4	123,399,442 (GRCm38)	missense	probably damaging	1.00
R7342:Macf1	UTSW	4	123,382,124 (GRCm38)	missense	probably damaging	1.00
R7409:Macf1	UTSW	4	123,504,470 (GRCm38)	missense	probably damaging	1.00
R7436:Macf1	UTSW	4	123,456,643 (GRCm38)	missense	probably benign
R7440:Macf1	UTSW	4	123,455,446 (GRCm38)	nonsense	probably null
R7462:Macf1	UTSW	4	123,492,763 (GRCm38)	missense	probably damaging	1.00
R7471:Macf1	UTSW	4	123,472,289 (GRCm38)	missense	probably benign	0.00
R7472:Macf1	UTSW	4	123,433,067 (GRCm38)	missense	probably benign	0.16
R7486:Macf1	UTSW	4	123,409,581 (GRCm38)	missense	probably benign	0.00
R7492:Macf1	UTSW	4	123,475,731 (GRCm38)	missense	possibly damaging	0.83
R7511:Macf1	UTSW	4	123,473,300 (GRCm38)	missense	possibly damaging	0.72
R7528:Macf1	UTSW	4	123,432,059 (GRCm38)	missense	possibly damaging	0.90
R7547:Macf1	UTSW	4	123,441,617 (GRCm38)	missense	probably damaging	1.00
R7592:Macf1	UTSW	4	123,410,893 (GRCm38)	intron	probably benign
R7723:Macf1	UTSW	4	123,432,924 (GRCm38)	missense	probably benign	0.00
R7731:Macf1	UTSW	4	123,444,879 (GRCm38)	missense	probably benign	0.19
R7739:Macf1	UTSW	4	123,385,598 (GRCm38)	missense	probably damaging	1.00
R7740:Macf1	UTSW	4	123,684,303 (GRCm38)	start gained	probably benign
R7798:Macf1	UTSW	4	123,378,100 (GRCm38)	missense	probably damaging	1.00
R7799:Macf1	UTSW	4	123,527,113 (GRCm38)	missense	probably benign	0.00
R7801:Macf1	UTSW	4	123,408,271 (GRCm38)	missense	probably damaging	0.97
R7842:Macf1	UTSW	4	123,526,909 (GRCm38)	missense	probably benign	0.12
R7849:Macf1	UTSW	4	123,407,599 (GRCm38)	missense	probably benign	0.00
R7873:Macf1	UTSW	4	123,504,551 (GRCm38)	critical splice acceptor site	probably null
R7933:Macf1	UTSW	4	123,409,651 (GRCm38)	missense	probably benign	0.00
R7934:Macf1	UTSW	4	123,473,934 (GRCm38)	missense	possibly damaging	0.89
R7947:Macf1	UTSW	4	123,401,407 (GRCm38)	missense	probably damaging	0.98
R7988:Macf1	UTSW	4	123,506,480 (GRCm38)	missense	probably damaging	1.00
R7992:Macf1	UTSW	4	123,395,960 (GRCm38)	missense	probably damaging	1.00
R8013:Macf1	UTSW	4	123,526,826 (GRCm38)	missense	probably benign	0.00
R8014:Macf1	UTSW	4	123,526,826 (GRCm38)	missense	probably benign	0.00
R8029:Macf1	UTSW	4	123,444,892 (GRCm38)	missense	possibly damaging	0.50
R8064:Macf1	UTSW	4	123,459,374 (GRCm38)	missense	possibly damaging	0.91
R8085:Macf1	UTSW	4	123,410,082 (GRCm38)	missense	possibly damaging	0.46
R8094:Macf1	UTSW	4	123,369,867 (GRCm38)	missense	probably damaging	0.99
R8099:Macf1	UTSW	4	123,476,129 (GRCm38)	missense	probably benign	0.22
R8147:Macf1	UTSW	4	123,491,698 (GRCm38)	missense	probably damaging	1.00
R8151:Macf1	UTSW	4	123,397,413 (GRCm38)	missense	possibly damaging	0.91
R8186:Macf1	UTSW	4	123,382,130 (GRCm38)	missense	possibly damaging	0.89
R8186:Macf1	UTSW	4	123,372,426 (GRCm38)	missense	probably damaging	1.00
R8192:Macf1	UTSW	4	123,440,597 (GRCm38)	missense	probably damaging	1.00
R8196:Macf1	UTSW	4	123,382,704 (GRCm38)	missense	probably damaging	1.00
R8260:Macf1	UTSW	4	123,472,070 (GRCm38)	missense	probably benign
R8305:Macf1	UTSW	4	123,395,621 (GRCm38)	intron	probably benign
R8333:Macf1	UTSW	4	123,385,452 (GRCm38)	splice site	probably null
R8334:Macf1	UTSW	4	123,432,108 (GRCm38)	missense	possibly damaging	0.82
R8344:Macf1	UTSW	4	123,526,856 (GRCm38)	missense	probably benign
R8344:Macf1	UTSW	4	123,384,683 (GRCm38)	missense	probably damaging	1.00
R8422:Macf1	UTSW	4	123,409,486 (GRCm38)	missense	possibly damaging	0.46
R8459:Macf1	UTSW	4	123,480,314 (GRCm38)	missense	possibly damaging	0.68
R8466:Macf1	UTSW	4	123,455,444 (GRCm38)	missense	probably benign	0.00
R8472:Macf1	UTSW	4	123,453,002 (GRCm38)	missense	probably damaging	1.00
R8556:Macf1	UTSW	4	123,488,343 (GRCm38)	missense	probably damaging	1.00
R8679:Macf1	UTSW	4	123,512,076 (GRCm38)	missense	probably benign	0.00
R8723:Macf1	UTSW	4	123,455,117 (GRCm38)	nonsense	probably null
R8732:Macf1	UTSW	4	123,509,770 (GRCm38)	critical splice donor site	probably null
R8747:Macf1	UTSW	4	123,355,151 (GRCm38)	missense	probably damaging	1.00
R8748:Macf1	UTSW	4	123,474,275 (GRCm38)	missense	probably benign	0.00
R8785:Macf1	UTSW	4	123,448,260 (GRCm38)	critical splice acceptor site	probably null
R8826:Macf1	UTSW	4	123,382,229 (GRCm38)	missense	probably damaging	1.00
R8828:Macf1	UTSW	4	123,408,411 (GRCm38)	missense	probably benign	0.01
R8833:Macf1	UTSW	4	123,471,341 (GRCm38)	missense	probably benign
R8889:Macf1	UTSW	4	123,355,243 (GRCm38)	missense	probably damaging	1.00
R8892:Macf1	UTSW	4	123,355,243 (GRCm38)	missense	probably damaging	1.00
R8893:Macf1	UTSW	4	123,410,530 (GRCm38)	missense	probably benign	0.27
R8899:Macf1	UTSW	4	123,475,059 (GRCm38)	missense	probably benign	0.00
R8956:Macf1	UTSW	4	123,474,848 (GRCm38)	missense	probably benign
R9037:Macf1	UTSW	4	123,471,725 (GRCm38)	missense	probably benign	0.03
R9086:Macf1	UTSW	4	123,484,151 (GRCm38)	missense	probably damaging	1.00
R9111:Macf1	UTSW	4	123,513,026 (GRCm38)	missense	probably damaging	1.00
R9126:Macf1	UTSW	4	123,382,400 (GRCm38)	missense	possibly damaging	0.88
R9139:Macf1	UTSW	4	123,434,771 (GRCm38)	missense	probably damaging	1.00
R9140:Macf1	UTSW	4	123,474,062 (GRCm38)	missense	possibly damaging	0.92
R9149:Macf1	UTSW	4	123,471,533 (GRCm38)	missense	probably benign	0.40
R9163:Macf1	UTSW	4	123,509,893 (GRCm38)	missense	probably damaging	1.00
R9177:Macf1	UTSW	4	123,473,789 (GRCm38)	missense	probably damaging	1.00
R9206:Macf1	UTSW	4	123,684,132 (GRCm38)	missense	unknown
R9208:Macf1	UTSW	4	123,684,132 (GRCm38)	missense	unknown
R9209:Macf1	UTSW	4	123,432,434 (GRCm38)	missense	probably damaging	1.00
R9219:Macf1	UTSW	4	123,407,761 (GRCm38)	missense	possibly damaging	0.81
R9224:Macf1	UTSW	4	123,432,897 (GRCm38)	missense	probably damaging	1.00
R9241:Macf1	UTSW	4	123,378,159 (GRCm38)	missense	probably damaging	1.00
R9268:Macf1	UTSW	4	123,473,789 (GRCm38)	missense	probably damaging	1.00
R9276:Macf1	UTSW	4	123,434,708 (GRCm38)	missense	probably damaging	1.00
R9296:Macf1	UTSW	4	123,506,453 (GRCm38)	missense	probably damaging	0.99
R9369:Macf1	UTSW	4	123,455,357 (GRCm38)	critical splice donor site	probably null
R9438:Macf1	UTSW	4	123,385,573 (GRCm38)	missense	probably benign	0.01
R9443:Macf1	UTSW	4	123,471,875 (GRCm38)	missense	probably benign
R9529:Macf1	UTSW	4	123,513,887 (GRCm38)	missense	probably damaging	1.00
R9600:Macf1	UTSW	4	123,471,209 (GRCm38)	missense	possibly damaging	0.76
R9613:Macf1	UTSW	4	123,526,495 (GRCm38)	missense	probably benign	0.41
R9686:Macf1	UTSW	4	123,483,698 (GRCm38)	missense	possibly damaging	0.64
R9689:Macf1	UTSW	4	123,471,861 (GRCm38)	missense	probably benign
R9740:Macf1	UTSW	4	123,473,060 (GRCm38)	missense	probably damaging	1.00
R9740:Macf1	UTSW	4	123,372,384 (GRCm38)	missense	probably damaging	1.00
R9764:Macf1	UTSW	4	123,472,343 (GRCm38)	missense	probably benign	0.02
R9779:Macf1	UTSW	4	123,454,996 (GRCm38)	missense	probably benign	0.02
RF011:Macf1	UTSW	4	123,473,855 (GRCm38)	missense	probably damaging	1.00
X0022:Macf1	UTSW	4	123,450,042 (GRCm38)	missense	probably damaging	0.99
X0027:Macf1	UTSW	4	123,503,269 (GRCm38)	missense	probably damaging	1.00
X0064:Macf1	UTSW	4	123,511,874 (GRCm38)	missense	probably damaging	1.00
Z1177:Macf1	UTSW	4	123,471,475 (GRCm38)	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- ACTCAGCAGATGGAGGCTTC -3'
(R):5'- TGGCCAGGGATTAATTCAGAG -3'

Sequencing Primer
(F):5'- CTGATTGGCTATGAGCTCCTCAG -3'
(R):5'- AACTGTGATGTGCAGGGTTTAGAAC -3'

Posted On

2018-05-24