Incidental Mutation 'R6429:Grhl3'
ID 518417
Institutional Source Beutler Lab
Gene Symbol Grhl3
Ensembl Gene ENSMUSG00000037188
Gene Name grainyhead like transcription factor 3
Synonyms ct, Som, Get1
MMRRC Submission 044567-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.952) question?
Stock # R6429 (G1)
Quality Score 158.009
Status Not validated
Chromosome 4
Chromosomal Location 135269199-135300941 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 135284507 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Valine at position 195 (D195V)
Ref Sequence ENSEMBL: ENSMUSP00000101481 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105855]
AlphaFold Q5FWH3
Predicted Effect probably damaging
Transcript: ENSMUST00000105855
AA Change: D195V

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000101481
Gene: ENSMUSG00000037188
AA Change: D195V

DomainStartEndE-ValueType
Pfam:CP2 215 421 2.5e-81 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the grainyhead family of transcription factors. The encoded protein may function as a transcription factor during development, and has been shown to stimulate migration of endothelial cells. Multiple transcript variants encoding distinct isoforms have been identified for this gene.[provided by RefSeq, Aug 2010]
PHENOTYPE: Mice homozygous for the variably penetrant curly-tail mutation (ct) show symptoms of cranial or spinal neural tube defects such as curly tails and/or spina bifida; homozygotes with more severe phenotypes display exencephaly and die in utero. Homozygous knockout mice show severe neural tube defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acacb G A 5: 114,366,652 (GRCm39) E1565K probably damaging Het
Amy1 T C 3: 113,363,158 (GRCm39) N63S probably damaging Het
Arhgef15 G T 11: 68,838,622 (GRCm39) N591K probably damaging Het
AW551984 A G 9: 39,511,910 (GRCm39) S34P probably damaging Het
C2cd3 A G 7: 100,081,298 (GRCm39) D127G probably damaging Het
Ccdc87 T A 19: 4,891,263 (GRCm39) V585E probably benign Het
Cemip2 T C 19: 21,779,272 (GRCm39) C361R probably benign Het
Cul2 T C 18: 3,421,345 (GRCm39) I223T probably damaging Het
Dgkq C T 5: 108,801,574 (GRCm39) V495M probably damaging Het
Dpp10 A G 1: 123,295,330 (GRCm39) I570T possibly damaging Het
Dstyk C T 1: 132,377,542 (GRCm39) Q383* probably null Het
Emilin2 C A 17: 71,617,951 (GRCm39) probably benign Het
Fnip1 A G 11: 54,406,393 (GRCm39) I1163M probably damaging Het
Fryl C T 5: 73,248,094 (GRCm39) E1008K possibly damaging Het
Gm35315 A T 5: 110,226,525 (GRCm39) Y305N possibly damaging Het
Ift56 T A 6: 38,375,248 (GRCm39) S250T possibly damaging Het
Il33 T C 19: 29,929,400 (GRCm39) F41S probably benign Het
Il4 A G 11: 53,504,736 (GRCm39) S15P possibly damaging Het
Inf2 C T 12: 112,570,690 (GRCm39) P410S probably benign Het
Kalrn T A 16: 34,152,534 (GRCm39) D349V possibly damaging Het
Krt4 A G 15: 101,831,229 (GRCm39) M224T probably benign Het
Lrp2 C T 2: 69,291,631 (GRCm39) S3516N probably damaging Het
Macf1 A T 4: 123,295,387 (GRCm39) probably null Het
Msr1 G A 8: 40,068,858 (GRCm39) P213S probably damaging Het
Nptx1 G T 11: 119,435,547 (GRCm39) C256* probably null Het
Nr1d1 T C 11: 98,662,840 (GRCm39) Y51C probably damaging Het
Or4c11c G A 2: 88,661,869 (GRCm39) R136Q probably benign Het
Panx3 T C 9: 37,572,461 (GRCm39) D363G probably damaging Het
Pira13 A T 7: 3,825,345 (GRCm39) H432Q possibly damaging Het
Prkag1 A G 15: 98,712,404 (GRCm39) F143L probably damaging Het
Ptger4 T C 15: 5,272,478 (GRCm39) K72R possibly damaging Het
Pvrig-ps A G 5: 138,340,312 (GRCm39) T28A probably benign Het
Rhod C T 19: 4,476,133 (GRCm39) C206Y probably benign Het
Rngtt C A 4: 33,320,606 (GRCm39) S51* probably null Het
Rreb1 T G 13: 38,116,105 (GRCm39) S1155A probably benign Het
Scn9a A C 2: 66,357,307 (GRCm39) I998S possibly damaging Het
Sfmbt1 T A 14: 30,495,868 (GRCm39) F50L probably damaging Het
Six4 A T 12: 73,150,247 (GRCm39) V766D probably damaging Het
Smpd1 T C 7: 105,206,135 (GRCm39) I421T probably damaging Het
Son T A 16: 91,455,054 (GRCm39) M1267K probably benign Het
Styk1 T A 6: 131,287,027 (GRCm39) D156V possibly damaging Het
Supt3 A G 17: 45,430,030 (GRCm39) E361G probably benign Het
Tbx3 T A 5: 119,812,256 (GRCm39) Y185* probably null Het
Trpm1 A T 7: 63,918,252 (GRCm39) T531S probably benign Het
Tspan32 T A 7: 142,572,479 (GRCm39) W172R possibly damaging Het
Urb1 A T 16: 90,559,318 (GRCm39) probably null Het
Vmn2r70 T A 7: 85,208,276 (GRCm39) I734F probably damaging Het
Vwa7 A G 17: 35,243,175 (GRCm39) T618A probably benign Het
Wac T A 18: 7,920,163 (GRCm39) V339E probably damaging Het
Wrn G A 8: 33,833,024 (GRCm39) T156M probably damaging Het
Zeb1 T A 18: 5,770,498 (GRCm39) C884S probably damaging Het
Zfp747l1 T C 7: 126,984,214 (GRCm39) probably benign Het
Zmpste24 A G 4: 120,952,867 (GRCm39) V10A probably damaging Het
Other mutations in Grhl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02638:Grhl3 APN 4 135,284,176 (GRCm39) missense probably benign 0.00
IGL02868:Grhl3 APN 4 135,281,915 (GRCm39) missense probably damaging 1.00
Bite-size UTSW 4 135,284,744 (GRCm39) missense possibly damaging 0.46
hammerkop UTSW 4 135,273,557 (GRCm39) missense probably damaging 1.00
hoopoe UTSW 4 135,286,457 (GRCm39) missense probably benign 0.00
Tropicbird UTSW 4 135,286,415 (GRCm39) nonsense probably null
R0121:Grhl3 UTSW 4 135,279,860 (GRCm39) missense probably damaging 0.97
R0180:Grhl3 UTSW 4 135,281,841 (GRCm39) missense probably benign 0.00
R0627:Grhl3 UTSW 4 135,279,992 (GRCm39) missense probably benign 0.18
R0727:Grhl3 UTSW 4 135,273,565 (GRCm39) missense possibly damaging 0.90
R1248:Grhl3 UTSW 4 135,288,617 (GRCm39) missense probably benign 0.01
R1664:Grhl3 UTSW 4 135,279,861 (GRCm39) missense probably benign 0.11
R2910:Grhl3 UTSW 4 135,286,457 (GRCm39) missense probably benign 0.00
R2911:Grhl3 UTSW 4 135,286,457 (GRCm39) missense probably benign 0.00
R3773:Grhl3 UTSW 4 135,283,158 (GRCm39) nonsense probably null
R4033:Grhl3 UTSW 4 135,300,735 (GRCm39) start codon destroyed probably benign
R4521:Grhl3 UTSW 4 135,273,561 (GRCm39) missense probably damaging 1.00
R4576:Grhl3 UTSW 4 135,288,562 (GRCm39) missense probably damaging 1.00
R4650:Grhl3 UTSW 4 135,276,547 (GRCm39) splice site probably null
R4697:Grhl3 UTSW 4 135,275,777 (GRCm39) missense probably damaging 1.00
R4919:Grhl3 UTSW 4 135,286,415 (GRCm39) nonsense probably null
R4920:Grhl3 UTSW 4 135,286,415 (GRCm39) nonsense probably null
R4961:Grhl3 UTSW 4 135,279,918 (GRCm39) missense probably damaging 1.00
R5100:Grhl3 UTSW 4 135,269,986 (GRCm39) missense probably benign
R5180:Grhl3 UTSW 4 135,286,415 (GRCm39) nonsense probably null
R5181:Grhl3 UTSW 4 135,286,415 (GRCm39) nonsense probably null
R5325:Grhl3 UTSW 4 135,286,415 (GRCm39) nonsense probably null
R6459:Grhl3 UTSW 4 135,284,744 (GRCm39) missense possibly damaging 0.46
R7047:Grhl3 UTSW 4 135,276,551 (GRCm39) splice site probably null
R7073:Grhl3 UTSW 4 135,300,723 (GRCm39) missense probably benign 0.00
R7345:Grhl3 UTSW 4 135,273,557 (GRCm39) missense probably damaging 1.00
R7797:Grhl3 UTSW 4 135,286,416 (GRCm39) missense possibly damaging 0.93
R7829:Grhl3 UTSW 4 135,288,532 (GRCm39) missense probably damaging 0.98
R8023:Grhl3 UTSW 4 135,277,640 (GRCm39) missense probably benign
R8472:Grhl3 UTSW 4 135,284,176 (GRCm39) missense probably benign 0.00
R8499:Grhl3 UTSW 4 135,276,549 (GRCm39) critical splice donor site probably null
R8766:Grhl3 UTSW 4 135,300,724 (GRCm39) missense probably benign 0.00
R8836:Grhl3 UTSW 4 135,288,640 (GRCm39) missense probably damaging 1.00
R9466:Grhl3 UTSW 4 135,283,412 (GRCm39) missense probably benign 0.06
Z1177:Grhl3 UTSW 4 135,279,997 (GRCm39) missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- AGAATAAGTGGCCATGTTCAGG -3'
(R):5'- AATCTGCTAGGCTTGGAGGG -3'

Sequencing Primer
(F):5'- GCAAATTTGGATGGCTGTACAC -3'
(R):5'- CTAGGCTTGGAGGGGGTTCTAC -3'
Posted On 2018-05-24