Incidental Mutation 'R6429:Tbx3'
ID 518422
Institutional Source Beutler Lab
Gene Symbol Tbx3
Ensembl Gene ENSMUSG00000018604
Gene Name T-box 3
Synonyms D5Ertd189e
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R6429 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 119670669-119684724 bp(+) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) T to A at 119674191 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Stop codon at position 185 (Y185*)
Ref Sequence ENSEMBL: ENSMUSP00000112519 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018748] [ENSMUST00000079719] [ENSMUST00000121021]
AlphaFold P70324
Predicted Effect probably null
Transcript: ENSMUST00000018748
AA Change: Y185*
SMART Domains Protein: ENSMUSP00000018748
Gene: ENSMUSG00000018604
AA Change: Y185*

DomainStartEndE-ValueType
low complexity region 46 63 N/A INTRINSIC
TBOX 102 310 6.4e-125 SMART
Pfam:TBX 323 411 8.8e-29 PFAM
low complexity region 492 510 N/A INTRINSIC
low complexity region 524 538 N/A INTRINSIC
low complexity region 556 576 N/A INTRINSIC
low complexity region 607 620 N/A INTRINSIC
low complexity region 662 710 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000079719
AA Change: Y185*
SMART Domains Protein: ENSMUSP00000078657
Gene: ENSMUSG00000018604
AA Change: Y185*

DomainStartEndE-ValueType
low complexity region 46 63 N/A INTRINSIC
TBOX 102 290 1.01e-127 SMART
Pfam:TBX 303 391 6.5e-29 PFAM
low complexity region 472 490 N/A INTRINSIC
low complexity region 504 518 N/A INTRINSIC
low complexity region 536 556 N/A INTRINSIC
low complexity region 587 600 N/A INTRINSIC
low complexity region 642 690 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000121021
AA Change: Y185*
SMART Domains Protein: ENSMUSP00000112519
Gene: ENSMUSG00000018604
AA Change: Y185*

DomainStartEndE-ValueType
low complexity region 46 63 N/A INTRINSIC
TBOX 102 290 1.01e-127 SMART
Pfam:TBX 303 391 6.5e-29 PFAM
low complexity region 472 490 N/A INTRINSIC
low complexity region 504 518 N/A INTRINSIC
low complexity region 536 556 N/A INTRINSIC
low complexity region 587 600 N/A INTRINSIC
low complexity region 642 690 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129108
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145647
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202034
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of a phylogenetically conserved family of genes that share a common DNA-binding domain, the T-box. T-box genes encode transcription factors involved in the regulation of developmental processes. This protein is a transcriptional repressor and is thought to play a role in the anterior/posterior axis of the tetrapod forelimb. Mutations in this gene cause ulnar-mammary syndrome, affecting limb, apocrine gland, tooth, hair, and genital development. Alternative splicing of this gene results in three transcript variants encoding different isoforms; however, the full length nature of one variant has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice die are embryonic lethal exhibiting defects in the yolk sac and limb defects. Female embryos show impaired mammary bud induction. Mice homozygous for hypomorphic alleles exhibit varying degrees of prenatal lethality and premature death, heart defects and limb abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130019O22Rik T C 7: 127,385,042 probably benign Het
Acacb G A 5: 114,228,591 E1565K probably damaging Het
Amy1 T C 3: 113,569,509 N63S probably damaging Het
Arhgef15 G T 11: 68,947,796 N591K probably damaging Het
AW551984 A G 9: 39,600,614 S34P probably damaging Het
C2cd3 A G 7: 100,432,091 D127G probably damaging Het
Ccdc87 T A 19: 4,841,235 V585E probably benign Het
Cul2 T C 18: 3,421,345 I223T probably damaging Het
Dgkq C T 5: 108,653,708 V495M probably damaging Het
Dpp10 A G 1: 123,367,601 I570T possibly damaging Het
Dstyk C T 1: 132,449,804 Q383* probably null Het
Emilin2 C A 17: 71,310,956 probably benign Het
Fnip1 A G 11: 54,515,567 I1163M probably damaging Het
Fryl C T 5: 73,090,751 E1008K possibly damaging Het
Gm15448 A T 7: 3,822,346 H432Q possibly damaging Het
Gm35315 A T 5: 110,078,659 Y305N possibly damaging Het
Grhl3 T A 4: 135,557,196 D195V probably damaging Het
Il33 T C 19: 29,952,000 F41S probably benign Het
Il4 A G 11: 53,613,909 S15P possibly damaging Het
Inf2 C T 12: 112,604,256 P410S probably benign Het
Kalrn T A 16: 34,332,164 D349V possibly damaging Het
Krt4 A G 15: 101,922,794 M224T probably benign Het
Lrp2 C T 2: 69,461,287 S3516N probably damaging Het
Macf1 A T 4: 123,401,594 probably null Het
Msr1 G A 8: 39,615,817 P213S probably damaging Het
Nptx1 G T 11: 119,544,721 C256* probably null Het
Nr1d1 T C 11: 98,772,014 Y51C probably damaging Het
Olfr1205 G A 2: 88,831,525 R136Q probably benign Het
Panx3 T C 9: 37,661,165 D363G probably damaging Het
Prkag1 A G 15: 98,814,523 F143L probably damaging Het
Ptger4 T C 15: 5,242,997 K72R possibly damaging Het
Pvrig A G 5: 138,342,050 T28A probably benign Het
Rhod C T 19: 4,426,105 C206Y probably benign Het
Rngtt C A 4: 33,320,606 S51* probably null Het
Rreb1 T G 13: 37,932,129 S1155A probably benign Het
Scn9a A C 2: 66,526,963 I998S possibly damaging Het
Sfmbt1 T A 14: 30,773,911 F50L probably damaging Het
Six4 A T 12: 73,103,473 V766D probably damaging Het
Smpd1 T C 7: 105,556,928 I421T probably damaging Het
Son T A 16: 91,658,166 M1267K probably benign Het
Styk1 T A 6: 131,310,064 D156V possibly damaging Het
Supt3 A G 17: 45,119,143 E361G probably benign Het
Tmem2 T C 19: 21,801,908 C361R probably benign Het
Trpm1 A T 7: 64,268,504 T531S probably benign Het
Tspan32 T A 7: 143,018,742 W172R possibly damaging Het
Ttc26 T A 6: 38,398,313 S250T possibly damaging Het
Urb1 A T 16: 90,762,430 probably null Het
Vmn2r70 T A 7: 85,559,068 I734F probably damaging Het
Vwa7 A G 17: 35,024,199 T618A probably benign Het
Wac T A 18: 7,920,163 V339E probably damaging Het
Wrn G A 8: 33,342,996 T156M probably damaging Het
Zeb1 T A 18: 5,770,498 C884S probably damaging Het
Zmpste24 A G 4: 121,095,670 V10A probably damaging Het
Other mutations in Tbx3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01960:Tbx3 APN 5 119682643 missense probably benign 0.45
IGL02174:Tbx3 APN 5 119675584 nonsense probably null
IGL02508:Tbx3 APN 5 119678812 missense possibly damaging 0.48
IGL03035:Tbx3 APN 5 119683096 utr 3 prime probably benign
R0047:Tbx3 UTSW 5 119680446 missense probably damaging 0.99
R0184:Tbx3 UTSW 5 119675562 missense probably damaging 1.00
R0365:Tbx3 UTSW 5 119675250 missense possibly damaging 0.81
R1209:Tbx3 UTSW 5 119680953 missense probably benign 0.19
R1956:Tbx3 UTSW 5 119680953 missense probably benign 0.19
R2231:Tbx3 UTSW 5 119677524 missense probably damaging 1.00
R4093:Tbx3 UTSW 5 119680748 missense probably benign
R4400:Tbx3 UTSW 5 119680571 missense probably damaging 0.99
R4578:Tbx3 UTSW 5 119682776 missense probably damaging 0.99
R4693:Tbx3 UTSW 5 119677570 missense possibly damaging 0.72
R4716:Tbx3 UTSW 5 119675670 missense possibly damaging 0.94
R4804:Tbx3 UTSW 5 119680512 missense possibly damaging 0.63
R5664:Tbx3 UTSW 5 119678731 missense possibly damaging 0.48
R5724:Tbx3 UTSW 5 119675603 missense possibly damaging 0.75
R5990:Tbx3 UTSW 5 119680529 missense probably benign 0.02
R6133:Tbx3 UTSW 5 119680953 missense probably benign 0.19
R6180:Tbx3 UTSW 5 119674067 missense probably damaging 1.00
R7154:Tbx3 UTSW 5 119672028 missense possibly damaging 0.89
R7195:Tbx3 UTSW 5 119675583 missense probably damaging 1.00
R7352:Tbx3 UTSW 5 119677560 missense probably benign 0.00
R7921:Tbx3 UTSW 5 119680869 missense possibly damaging 0.76
R7921:Tbx3 UTSW 5 119680870 missense probably benign 0.01
R8050:Tbx3 UTSW 5 119683067 missense probably benign 0.38
R8089:Tbx3 UTSW 5 119680569 missense probably damaging 0.98
R8351:Tbx3 UTSW 5 119680776 missense probably damaging 1.00
R8422:Tbx3 UTSW 5 119680516 missense possibly damaging 0.94
R8885:Tbx3 UTSW 5 119680559 missense probably benign
R8891:Tbx3 UTSW 5 119671918 start gained probably benign
R8987:Tbx3 UTSW 5 119680821 missense possibly damaging 0.78
R9240:Tbx3 UTSW 5 119680895 missense probably benign
X0063:Tbx3 UTSW 5 119680881 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTTCTGAGCCATTTACGGG -3'
(R):5'- GGCCCAAATTCTGAGTTTACC -3'

Sequencing Primer
(F):5'- AGCCATTTACGGGGTGGGC -3'
(R):5'- TTCTGAGTTTACCAGGAAGCCAGAC -3'
Posted On 2018-05-24