Incidental Mutation 'R6429:Vmn2r70'
ID518428
Institutional Source Beutler Lab
Gene Symbol Vmn2r70
Ensembl Gene ENSMUSG00000090806
Gene Namevomeronasal 2, receptor 70
SynonymsEG620835
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.162) question?
Stock #R6429 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location85558703-85569088 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 85559068 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 734 (I734F)
Ref Sequence ENSEMBL: ENSMUSP00000129703 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168230]
Predicted Effect probably damaging
Transcript: ENSMUST00000168230
AA Change: I734F

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000129703
Gene: ENSMUSG00000090806
AA Change: I734F

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:ANF_receptor 77 468 2.5e-28 PFAM
Pfam:NCD3G 510 562 1.5e-19 PFAM
Pfam:7tm_3 592 830 1.2e-52 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130019O22Rik T C 7: 127,385,042 probably benign Het
Acacb G A 5: 114,228,591 E1565K probably damaging Het
Amy1 T C 3: 113,569,509 N63S probably damaging Het
Arhgef15 G T 11: 68,947,796 N591K probably damaging Het
AW551984 A G 9: 39,600,614 S34P probably damaging Het
C2cd3 A G 7: 100,432,091 D127G probably damaging Het
Ccdc87 T A 19: 4,841,235 V585E probably benign Het
Cul2 T C 18: 3,421,345 I223T probably damaging Het
Dgkq C T 5: 108,653,708 V495M probably damaging Het
Dpp10 A G 1: 123,367,601 I570T possibly damaging Het
Dstyk C T 1: 132,449,804 Q383* probably null Het
Emilin2 C A 17: 71,310,956 probably benign Het
Fnip1 A G 11: 54,515,567 I1163M probably damaging Het
Fryl C T 5: 73,090,751 E1008K possibly damaging Het
Gm15448 A T 7: 3,822,346 H432Q possibly damaging Het
Gm35315 A T 5: 110,078,659 Y305N possibly damaging Het
Grhl3 T A 4: 135,557,196 D195V probably damaging Het
Il33 T C 19: 29,952,000 F41S probably benign Het
Il4 A G 11: 53,613,909 S15P possibly damaging Het
Inf2 C T 12: 112,604,256 P410S probably benign Het
Kalrn T A 16: 34,332,164 D349V possibly damaging Het
Krt4 A G 15: 101,922,794 M224T probably benign Het
Lrp2 C T 2: 69,461,287 S3516N probably damaging Het
Macf1 A T 4: 123,401,594 probably null Het
Msr1 G A 8: 39,615,817 P213S probably damaging Het
Nptx1 G T 11: 119,544,721 C256* probably null Het
Nr1d1 T C 11: 98,772,014 Y51C probably damaging Het
Olfr1205 G A 2: 88,831,525 R136Q probably benign Het
Panx3 T C 9: 37,661,165 D363G probably damaging Het
Prkag1 A G 15: 98,814,523 F143L probably damaging Het
Ptger4 T C 15: 5,242,997 K72R possibly damaging Het
Pvrig A G 5: 138,342,050 T28A probably benign Het
Rhod C T 19: 4,426,105 C206Y probably benign Het
Rngtt C A 4: 33,320,606 S51* probably null Het
Rreb1 T G 13: 37,932,129 S1155A probably benign Het
Scn9a A C 2: 66,526,963 I998S possibly damaging Het
Sfmbt1 T A 14: 30,773,911 F50L probably damaging Het
Six4 A T 12: 73,103,473 V766D probably damaging Het
Smpd1 T C 7: 105,556,928 I421T probably damaging Het
Son T A 16: 91,658,166 M1267K probably benign Het
Styk1 T A 6: 131,310,064 D156V possibly damaging Het
Supt3 A G 17: 45,119,143 E361G probably benign Het
Tbx3 T A 5: 119,674,191 Y185* probably null Het
Tmem2 T C 19: 21,801,908 C361R probably benign Het
Trpm1 A T 7: 64,268,504 T531S probably benign Het
Tspan32 T A 7: 143,018,742 W172R possibly damaging Het
Ttc26 T A 6: 38,398,313 S250T possibly damaging Het
Urb1 A T 16: 90,762,430 probably null Het
Vwa7 A G 17: 35,024,199 T618A probably benign Het
Wac T A 18: 7,920,163 V339E probably damaging Het
Wrn G A 8: 33,342,996 T156M probably damaging Het
Zeb1 T A 18: 5,770,498 C884S probably damaging Het
Zmpste24 A G 4: 121,095,670 V10A probably damaging Het
Other mutations in Vmn2r70
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00978:Vmn2r70 APN 7 85563799 missense probably benign 0.00
IGL01140:Vmn2r70 APN 7 85565171 nonsense probably null
IGL01287:Vmn2r70 APN 7 85569019 nonsense probably null
IGL01581:Vmn2r70 APN 7 85563914 splice site probably null
IGL01632:Vmn2r70 APN 7 85566072 missense probably benign 0.00
IGL01725:Vmn2r70 APN 7 85559386 missense probably damaging 1.00
IGL02244:Vmn2r70 APN 7 85565003 missense probably benign
IGL02288:Vmn2r70 APN 7 85565134 missense probably benign 0.31
IGL02313:Vmn2r70 APN 7 85565168 missense probably damaging 0.99
IGL02591:Vmn2r70 APN 7 85564945 missense probably damaging 0.96
IGL02725:Vmn2r70 APN 7 85565345 missense possibly damaging 0.46
IGL02797:Vmn2r70 APN 7 85559087 missense probably benign 0.00
R0045:Vmn2r70 UTSW 7 85566044 missense probably damaging 1.00
R0729:Vmn2r70 UTSW 7 85565904 missense probably benign 0.00
R0967:Vmn2r70 UTSW 7 85559619 missense probably damaging 0.99
R1217:Vmn2r70 UTSW 7 85559061 missense probably damaging 1.00
R1351:Vmn2r70 UTSW 7 85565054 missense probably damaging 1.00
R1387:Vmn2r70 UTSW 7 85558761 missense probably benign 0.12
R1483:Vmn2r70 UTSW 7 85559167 missense probably benign 0.04
R1796:Vmn2r70 UTSW 7 85563803 nonsense probably null
R1809:Vmn2r70 UTSW 7 85565922 missense probably benign 0.23
R2154:Vmn2r70 UTSW 7 85563715 missense possibly damaging 0.67
R2173:Vmn2r70 UTSW 7 85565082 missense probably benign
R2334:Vmn2r70 UTSW 7 85559592 missense probably benign 0.05
R2871:Vmn2r70 UTSW 7 85559019 missense probably damaging 1.00
R2871:Vmn2r70 UTSW 7 85559019 missense probably damaging 1.00
R3975:Vmn2r70 UTSW 7 85559332 missense probably benign 0.00
R4525:Vmn2r70 UTSW 7 85559579 missense probably damaging 1.00
R4527:Vmn2r70 UTSW 7 85559579 missense probably damaging 1.00
R4535:Vmn2r70 UTSW 7 85565333 missense probably damaging 1.00
R5181:Vmn2r70 UTSW 7 85559179 missense probably damaging 0.99
R5600:Vmn2r70 UTSW 7 85563727 missense probably benign 0.07
R5641:Vmn2r70 UTSW 7 85559364 missense probably damaging 0.99
R5726:Vmn2r70 UTSW 7 85559107 missense probably damaging 1.00
R5943:Vmn2r70 UTSW 7 85565991 missense probably benign 0.09
R6166:Vmn2r70 UTSW 7 85565981 missense probably benign 0.25
R6272:Vmn2r70 UTSW 7 85558986 missense probably damaging 1.00
R6324:Vmn2r70 UTSW 7 85558879 missense probably benign 0.01
R6449:Vmn2r70 UTSW 7 85564949 missense probably damaging 1.00
R6512:Vmn2r70 UTSW 7 85566097 missense probably benign
R7000:Vmn2r70 UTSW 7 85559611 missense probably damaging 0.99
R7141:Vmn2r70 UTSW 7 85558836 missense probably benign
R7153:Vmn2r70 UTSW 7 85565054 missense probably damaging 1.00
R7424:Vmn2r70 UTSW 7 85563868 missense probably damaging 1.00
R7565:Vmn2r70 UTSW 7 85565291 missense probably benign 0.35
R7567:Vmn2r70 UTSW 7 85565035 missense probably benign 0.41
R7593:Vmn2r70 UTSW 7 85566104 nonsense probably null
R7660:Vmn2r70 UTSW 7 85568922 missense probably damaging 0.99
R7806:Vmn2r70 UTSW 7 85559193 missense probably benign
R7892:Vmn2r70 UTSW 7 85559380 missense possibly damaging 0.58
R7965:Vmn2r70 UTSW 7 85561863 missense probably damaging 0.96
R8052:Vmn2r70 UTSW 7 85563715 missense probably benign
R8251:Vmn2r70 UTSW 7 85565978 nonsense probably null
Z1088:Vmn2r70 UTSW 7 85564760 missense possibly damaging 0.53
Z1176:Vmn2r70 UTSW 7 85569045 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTTCCACGGCAACCATAGTC -3'
(R):5'- GCTTTCAAGATAACTGTCCCCGG -3'

Sequencing Primer
(F):5'- GGCAACCATAGTCTTGCCTTTGG -3'
(R):5'- TTCAAGATAACTGTCCCCGGAAGAAG -3'
Posted On2018-05-24