Incidental Mutation 'R6429:C2cd3'
ID518429
Institutional Source Beutler Lab
Gene Symbol C2cd3
Ensembl Gene ENSMUSG00000047248
Gene NameC2 calcium-dependent domain containing 3
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6429 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location100372233-100470152 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 100432091 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 127 (D127G)
Ref Sequence ENSEMBL: ENSMUSP00000113728 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051777] [ENSMUST00000098259] [ENSMUST00000120196]
Predicted Effect probably damaging
Transcript: ENSMUST00000051777
AA Change: D1358G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000062637
Gene: ENSMUSG00000047248
AA Change: D1358G

DomainStartEndE-ValueType
low complexity region 2 19 N/A INTRINSIC
low complexity region 406 417 N/A INTRINSIC
C2 524 662 2.36e1 SMART
C2 790 899 3.73e0 SMART
C2 989 1129 1.47e1 SMART
C2 1182 1321 1.63e1 SMART
C2 1617 1724 1.43e-2 SMART
low complexity region 1892 1906 N/A INTRINSIC
low complexity region 2037 2049 N/A INTRINSIC
low complexity region 2110 2125 N/A INTRINSIC
low complexity region 2180 2197 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000098259
AA Change: D1358G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000095859
Gene: ENSMUSG00000047248
AA Change: D1358G

DomainStartEndE-ValueType
low complexity region 2 19 N/A INTRINSIC
low complexity region 406 417 N/A INTRINSIC
C2 524 662 2.36e1 SMART
C2 790 899 3.73e0 SMART
C2 989 1129 1.47e1 SMART
C2 1182 1321 1.63e1 SMART
C2 1617 1724 1.43e-2 SMART
low complexity region 1892 1906 N/A INTRINSIC
low complexity region 2037 2049 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000119647
AA Change: D980G

PolyPhen 2 Score 0.913 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000113360
Gene: ENSMUSG00000047248
AA Change: D980G

DomainStartEndE-ValueType
C2 61 199 2.36e1 SMART
C2 327 436 3.73e0 SMART
C2 526 666 1.47e1 SMART
C2 719 858 1.63e1 SMART
C2 1154 1261 1.43e-2 SMART
low complexity region 1429 1443 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000120196
AA Change: D127G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113728
Gene: ENSMUSG00000047248
AA Change: D127G

DomainStartEndE-ValueType
low complexity region 297 308 N/A INTRINSIC
C2 415 553 1.5e-1 SMART
C2 681 790 2.4e-2 SMART
C2 880 1020 9.5e-2 SMART
C2 1073 1212 1.1e-1 SMART
C2 1508 1615 9e-5 SMART
low complexity region 1783 1797 N/A INTRINSIC
low complexity region 1928 1940 N/A INTRINSIC
low complexity region 2001 2016 N/A INTRINSIC
low complexity region 2071 2087 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185051
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that functions as a regulator of centriole elongation. Studies of the orthologous mouse protein show that it promotes centriolar distal appendage assembly and is also required for the recruitment of other ciliogenic proteins, including intraflagellar transport proteins. Mutations in this gene cause orofaciodigital syndrome XIV (OFD14), a ciliopathy resulting in malformations of the oral cavity, face and digits. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Nov 2014]
PHENOTYPE: Homozygotes inactivating allele are embryonic lethal with pericardial edema and twisted body axis, abnormal patterning of brain and open neural tube defect. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130019O22Rik T C 7: 127,385,042 probably benign Het
Acacb G A 5: 114,228,591 E1565K probably damaging Het
Amy1 T C 3: 113,569,509 N63S probably damaging Het
Arhgef15 G T 11: 68,947,796 N591K probably damaging Het
AW551984 A G 9: 39,600,614 S34P probably damaging Het
Ccdc87 T A 19: 4,841,235 V585E probably benign Het
Cul2 T C 18: 3,421,345 I223T probably damaging Het
Dgkq C T 5: 108,653,708 V495M probably damaging Het
Dpp10 A G 1: 123,367,601 I570T possibly damaging Het
Dstyk C T 1: 132,449,804 Q383* probably null Het
Emilin2 C A 17: 71,310,956 probably benign Het
Fnip1 A G 11: 54,515,567 I1163M probably damaging Het
Fryl C T 5: 73,090,751 E1008K possibly damaging Het
Gm15448 A T 7: 3,822,346 H432Q possibly damaging Het
Gm35315 A T 5: 110,078,659 Y305N possibly damaging Het
Grhl3 T A 4: 135,557,196 D195V probably damaging Het
Il33 T C 19: 29,952,000 F41S probably benign Het
Il4 A G 11: 53,613,909 S15P possibly damaging Het
Inf2 C T 12: 112,604,256 P410S probably benign Het
Kalrn T A 16: 34,332,164 D349V possibly damaging Het
Krt4 A G 15: 101,922,794 M224T probably benign Het
Lrp2 C T 2: 69,461,287 S3516N probably damaging Het
Macf1 A T 4: 123,401,594 probably null Het
Msr1 G A 8: 39,615,817 P213S probably damaging Het
Nptx1 G T 11: 119,544,721 C256* probably null Het
Nr1d1 T C 11: 98,772,014 Y51C probably damaging Het
Olfr1205 G A 2: 88,831,525 R136Q probably benign Het
Panx3 T C 9: 37,661,165 D363G probably damaging Het
Prkag1 A G 15: 98,814,523 F143L probably damaging Het
Ptger4 T C 15: 5,242,997 K72R possibly damaging Het
Pvrig A G 5: 138,342,050 T28A probably benign Het
Rhod C T 19: 4,426,105 C206Y probably benign Het
Rngtt C A 4: 33,320,606 S51* probably null Het
Rreb1 T G 13: 37,932,129 S1155A probably benign Het
Scn9a A C 2: 66,526,963 I998S possibly damaging Het
Sfmbt1 T A 14: 30,773,911 F50L probably damaging Het
Six4 A T 12: 73,103,473 V766D probably damaging Het
Smpd1 T C 7: 105,556,928 I421T probably damaging Het
Son T A 16: 91,658,166 M1267K probably benign Het
Styk1 T A 6: 131,310,064 D156V possibly damaging Het
Supt3 A G 17: 45,119,143 E361G probably benign Het
Tbx3 T A 5: 119,674,191 Y185* probably null Het
Tmem2 T C 19: 21,801,908 C361R probably benign Het
Trpm1 A T 7: 64,268,504 T531S probably benign Het
Tspan32 T A 7: 143,018,742 W172R possibly damaging Het
Ttc26 T A 6: 38,398,313 S250T possibly damaging Het
Urb1 A T 16: 90,762,430 probably null Het
Vmn2r70 T A 7: 85,559,068 I734F probably damaging Het
Vwa7 A G 17: 35,024,199 T618A probably benign Het
Wac T A 18: 7,920,163 V339E probably damaging Het
Wrn G A 8: 33,342,996 T156M probably damaging Het
Zeb1 T A 18: 5,770,498 C884S probably damaging Het
Zmpste24 A G 4: 121,095,670 V10A probably damaging Het
Other mutations in C2cd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00540:C2cd3 APN 7 100391128 missense probably benign 0.14
IGL01420:C2cd3 APN 7 100454858 missense probably benign 0.35
IGL01775:C2cd3 APN 7 100443431 missense probably damaging 1.00
IGL01832:C2cd3 APN 7 100427214 missense possibly damaging 0.94
IGL01883:C2cd3 APN 7 100374486 missense possibly damaging 0.80
IGL02664:C2cd3 APN 7 100419715 missense possibly damaging 0.67
IGL02697:C2cd3 APN 7 100427169 unclassified probably benign
IGL02852:C2cd3 APN 7 100430189 missense probably damaging 1.00
IGL03158:C2cd3 APN 7 100374476 missense probably damaging 1.00
R0012:C2cd3 UTSW 7 100418522 missense possibly damaging 0.52
R0012:C2cd3 UTSW 7 100418522 missense possibly damaging 0.52
R0013:C2cd3 UTSW 7 100416062 missense probably damaging 1.00
R0013:C2cd3 UTSW 7 100416062 missense probably damaging 1.00
R0032:C2cd3 UTSW 7 100444445 unclassified probably benign
R0032:C2cd3 UTSW 7 100444445 unclassified probably benign
R0124:C2cd3 UTSW 7 100469518 missense probably benign
R0387:C2cd3 UTSW 7 100422507 splice site probably benign
R0522:C2cd3 UTSW 7 100395222 missense probably benign 0.14
R1124:C2cd3 UTSW 7 100422681 missense probably benign 0.00
R1484:C2cd3 UTSW 7 100440190 missense probably damaging 1.00
R1533:C2cd3 UTSW 7 100406077 missense possibly damaging 0.54
R1631:C2cd3 UTSW 7 100372497 critical splice donor site probably null
R1875:C2cd3 UTSW 7 100407025 missense possibly damaging 0.89
R2059:C2cd3 UTSW 7 100455493 unclassified probably benign
R2060:C2cd3 UTSW 7 100454948 missense probably damaging 1.00
R2348:C2cd3 UTSW 7 100413366 missense probably damaging 1.00
R3103:C2cd3 UTSW 7 100395252 missense possibly damaging 0.47
R3405:C2cd3 UTSW 7 100390166 missense probably benign 0.01
R3687:C2cd3 UTSW 7 100435833 missense probably benign 0.28
R3775:C2cd3 UTSW 7 100431998 missense probably damaging 1.00
R3854:C2cd3 UTSW 7 100454601 critical splice acceptor site probably null
R4359:C2cd3 UTSW 7 100441089 missense probably damaging 1.00
R4403:C2cd3 UTSW 7 100432099 missense probably damaging 1.00
R4446:C2cd3 UTSW 7 100374477 missense probably damaging 1.00
R4646:C2cd3 UTSW 7 100372450 unclassified probably benign
R4705:C2cd3 UTSW 7 100395188 missense possibly damaging 0.77
R4770:C2cd3 UTSW 7 100443435 missense probably damaging 1.00
R4777:C2cd3 UTSW 7 100416332 missense possibly damaging 0.46
R4816:C2cd3 UTSW 7 100391019 missense probably benign 0.01
R4842:C2cd3 UTSW 7 100416190 missense probably benign 0.00
R4858:C2cd3 UTSW 7 100454953 missense probably damaging 1.00
R4871:C2cd3 UTSW 7 100413374 missense possibly damaging 0.79
R4898:C2cd3 UTSW 7 100405959 missense probably damaging 1.00
R5026:C2cd3 UTSW 7 100459842 missense possibly damaging 0.52
R5112:C2cd3 UTSW 7 100443485 missense possibly damaging 0.91
R5242:C2cd3 UTSW 7 100390166 missense probably benign 0.01
R5538:C2cd3 UTSW 7 100455493 critical splice donor site probably null
R5861:C2cd3 UTSW 7 100444475 unclassified probably benign
R6110:C2cd3 UTSW 7 100441076 missense probably damaging 1.00
R6326:C2cd3 UTSW 7 100416428 missense probably benign 0.02
R6610:C2cd3 UTSW 7 100455298 missense probably benign
R6613:C2cd3 UTSW 7 100395241 missense possibly damaging 0.87
R6631:C2cd3 UTSW 7 100418540 missense probably damaging 1.00
R6787:C2cd3 UTSW 7 100455346 missense probably benign
R6837:C2cd3 UTSW 7 100448746 missense probably damaging 1.00
R6849:C2cd3 UTSW 7 100406927 missense probably damaging 1.00
R6860:C2cd3 UTSW 7 100390241 missense probably benign 0.28
R6929:C2cd3 UTSW 7 100451619 missense probably damaging 1.00
R7026:C2cd3 UTSW 7 100432092 missense probably damaging 1.00
R7088:C2cd3 UTSW 7 100416181 missense
R7174:C2cd3 UTSW 7 100432198 missense
R7241:C2cd3 UTSW 7 100407050 missense
R7335:C2cd3 UTSW 7 100422603 missense
R7357:C2cd3 UTSW 7 100430103 missense
R7493:C2cd3 UTSW 7 100427226 missense
R7567:C2cd3 UTSW 7 100430815 missense
R7573:C2cd3 UTSW 7 100419707 missense
X0002:C2cd3 UTSW 7 100440235 missense possibly damaging 0.50
Predicted Primers PCR Primer
(F):5'- TCTATTCAGCACTGGGCCAG -3'
(R):5'- AAAGGCTTCTTGATTGTACAGC -3'

Sequencing Primer
(F):5'- ACTGGGCCAGGGTAGTG -3'
(R):5'- GTAGCGAAGGTAGCAATATGTATTC -3'
Posted On2018-05-24