Incidental Mutation 'R6429:9130019O22Rik'
ID 518431
Institutional Source Beutler Lab
Gene Symbol 9130019O22Rik
Ensembl Gene ENSMUSG00000030823
Gene Name RIKEN cDNA 9130019O22 gene
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock # R6429 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 127382260-127387166 bp(-) (GRCm38)
Type of Mutation unclassified
DNA Base Change (assembly) T to C at 127385042 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000126288 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049052] [ENSMUST00000164345] [ENSMUST00000165495]
AlphaFold G3X941
Predicted Effect unknown
Transcript: ENSMUST00000049052
AA Change: D296G
SMART Domains Protein: ENSMUSP00000038195
Gene: ENSMUSG00000030823
AA Change: D296G

DomainStartEndE-ValueType
KRAB 22 82 5.44e-25 SMART
low complexity region 102 115 N/A INTRINSIC
ZnF_C2H2 152 174 6.88e-4 SMART
ZnF_C2H2 180 202 1.47e-3 SMART
ZnF_C2H2 208 230 5.29e-5 SMART
ZnF_C2H2 236 258 4.87e-4 SMART
ZnF_C2H2 264 286 3.69e-4 SMART
ZnF_C2H2 292 314 1.47e-3 SMART
ZnF_C2H2 320 342 5.21e-4 SMART
ZnF_C2H2 348 370 1.45e-2 SMART
ZnF_C2H2 376 398 2.12e-4 SMART
ZnF_C2H2 404 427 1.45e-2 SMART
ZnF_C2H2 433 455 3.69e-4 SMART
ZnF_C2H2 461 483 6.67e-2 SMART
ZnF_C2H2 489 511 1.67e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000164345
SMART Domains Protein: ENSMUSP00000131610
Gene: ENSMUSG00000030823

DomainStartEndE-ValueType
KRAB 22 67 1.65e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000165495
SMART Domains Protein: ENSMUSP00000126288
Gene: ENSMUSG00000078580

DomainStartEndE-ValueType
KRAB 22 82 4.09e-29 SMART
ZnF_C2H2 168 190 2.2e-2 SMART
ZnF_C2H2 196 218 4.79e-3 SMART
ZnF_C2H2 224 246 4.3e-5 SMART
ZnF_C2H2 252 274 7.9e-4 SMART
ZnF_C2H2 280 302 9.58e-3 SMART
ZnF_C2H2 308 331 2.36e-2 SMART
ZnF_C2H2 337 359 2.57e-3 SMART
ZnF_C2H2 365 387 1.69e-3 SMART
ZnF_C2H2 393 415 2.2e-2 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acacb G A 5: 114,228,591 E1565K probably damaging Het
Amy1 T C 3: 113,569,509 N63S probably damaging Het
Arhgef15 G T 11: 68,947,796 N591K probably damaging Het
AW551984 A G 9: 39,600,614 S34P probably damaging Het
C2cd3 A G 7: 100,432,091 D127G probably damaging Het
Ccdc87 T A 19: 4,841,235 V585E probably benign Het
Cul2 T C 18: 3,421,345 I223T probably damaging Het
Dgkq C T 5: 108,653,708 V495M probably damaging Het
Dpp10 A G 1: 123,367,601 I570T possibly damaging Het
Dstyk C T 1: 132,449,804 Q383* probably null Het
Emilin2 C A 17: 71,310,956 probably benign Het
Fnip1 A G 11: 54,515,567 I1163M probably damaging Het
Fryl C T 5: 73,090,751 E1008K possibly damaging Het
Gm15448 A T 7: 3,822,346 H432Q possibly damaging Het
Gm35315 A T 5: 110,078,659 Y305N possibly damaging Het
Grhl3 T A 4: 135,557,196 D195V probably damaging Het
Il33 T C 19: 29,952,000 F41S probably benign Het
Il4 A G 11: 53,613,909 S15P possibly damaging Het
Inf2 C T 12: 112,604,256 P410S probably benign Het
Kalrn T A 16: 34,332,164 D349V possibly damaging Het
Krt4 A G 15: 101,922,794 M224T probably benign Het
Lrp2 C T 2: 69,461,287 S3516N probably damaging Het
Macf1 A T 4: 123,401,594 probably null Het
Msr1 G A 8: 39,615,817 P213S probably damaging Het
Nptx1 G T 11: 119,544,721 C256* probably null Het
Nr1d1 T C 11: 98,772,014 Y51C probably damaging Het
Olfr1205 G A 2: 88,831,525 R136Q probably benign Het
Panx3 T C 9: 37,661,165 D363G probably damaging Het
Prkag1 A G 15: 98,814,523 F143L probably damaging Het
Ptger4 T C 15: 5,242,997 K72R possibly damaging Het
Pvrig A G 5: 138,342,050 T28A probably benign Het
Rhod C T 19: 4,426,105 C206Y probably benign Het
Rngtt C A 4: 33,320,606 S51* probably null Het
Rreb1 T G 13: 37,932,129 S1155A probably benign Het
Scn9a A C 2: 66,526,963 I998S possibly damaging Het
Sfmbt1 T A 14: 30,773,911 F50L probably damaging Het
Six4 A T 12: 73,103,473 V766D probably damaging Het
Smpd1 T C 7: 105,556,928 I421T probably damaging Het
Son T A 16: 91,658,166 M1267K probably benign Het
Styk1 T A 6: 131,310,064 D156V possibly damaging Het
Supt3 A G 17: 45,119,143 E361G probably benign Het
Tbx3 T A 5: 119,674,191 Y185* probably null Het
Tmem2 T C 19: 21,801,908 C361R probably benign Het
Trpm1 A T 7: 64,268,504 T531S probably benign Het
Tspan32 T A 7: 143,018,742 W172R possibly damaging Het
Ttc26 T A 6: 38,398,313 S250T possibly damaging Het
Urb1 A T 16: 90,762,430 probably null Het
Vmn2r70 T A 7: 85,559,068 I734F probably damaging Het
Vwa7 A G 17: 35,024,199 T618A probably benign Het
Wac T A 18: 7,920,163 V339E probably damaging Het
Wrn G A 8: 33,342,996 T156M probably damaging Het
Zeb1 T A 18: 5,770,498 C884S probably damaging Het
Zmpste24 A G 4: 121,095,670 V10A probably damaging Het
Other mutations in 9130019O22Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00561:9130019O22Rik APN 7 127386544 unclassified probably benign
IGL03102:9130019O22Rik APN 7 127384779 missense probably benign 0.01
IGL03264:9130019O22Rik APN 7 127385639 unclassified probably benign
R1653:9130019O22Rik UTSW 7 127384480 missense possibly damaging 0.71
R1692:9130019O22Rik UTSW 7 127384480 missense possibly damaging 0.71
R2042:9130019O22Rik UTSW 7 127385469 missense possibly damaging 0.93
R2132:9130019O22Rik UTSW 7 127386935 missense probably benign
R3768:9130019O22Rik UTSW 7 127384863 unclassified probably benign
R3769:9130019O22Rik UTSW 7 127384863 unclassified probably benign
R3770:9130019O22Rik UTSW 7 127384863 unclassified probably benign
R4459:9130019O22Rik UTSW 7 127384745 missense probably damaging 0.98
R4461:9130019O22Rik UTSW 7 127384745 missense probably damaging 0.98
R4839:9130019O22Rik UTSW 7 127385007 missense probably benign 0.32
R4903:9130019O22Rik UTSW 7 127385406 missense probably benign 0.02
R5231:9130019O22Rik UTSW 7 127385414 missense probably damaging 0.98
R5324:9130019O22Rik UTSW 7 127384907 unclassified probably benign
R5735:9130019O22Rik UTSW 7 127385407 missense possibly damaging 0.60
R5808:9130019O22Rik UTSW 7 127384913 unclassified probably benign
R6571:9130019O22Rik UTSW 7 127385138 unclassified probably benign
R6655:9130019O22Rik UTSW 7 127384340 missense possibly damaging 0.96
R6806:9130019O22Rik UTSW 7 127386594 unclassified probably benign
R6962:9130019O22Rik UTSW 7 127384315 missense possibly damaging 0.70
R7091:9130019O22Rik UTSW 7 127384362 missense possibly damaging 0.70
R7204:9130019O22Rik UTSW 7 127384346 missense possibly damaging 0.92
R7218:9130019O22Rik UTSW 7 127384680 missense probably benign 0.32
R7570:9130019O22Rik UTSW 7 127385283 missense probably benign 0.00
R7604:9130019O22Rik UTSW 7 127386535 missense unknown
R7661:9130019O22Rik UTSW 7 127384963 nonsense probably null
R7893:9130019O22Rik UTSW 7 127386544 unclassified probably benign
R8323:9130019O22Rik UTSW 7 127384449 missense possibly damaging 0.71
R9172:9130019O22Rik UTSW 7 127385454 missense probably benign 0.38
R9204:9130019O22Rik UTSW 7 127385160 missense unknown
Predicted Primers PCR Primer
(F):5'- GCAATCAGGGCAATTGAATGAC -3'
(R):5'- TTTACCCAGCGGTCCAAACTG -3'

Sequencing Primer
(F):5'- CAGGGCAATTGAATGACTTTTCGC -3'
(R):5'- GAAAAGCCGTTTCAGTGCC -3'
Posted On 2018-05-24