Incidental Mutation 'R6429:Six4'
ID518442
Institutional Source Beutler Lab
Gene Symbol Six4
Ensembl Gene ENSMUSG00000034460
Gene Namesine oculis-related homeobox 4
SynonymsTrexBF, AREC3
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6429 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location73099609-73113456 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 73103473 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 766 (V766D)
Ref Sequence ENSEMBL: ENSMUSP00000036150 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043208] [ENSMUST00000175693]
Predicted Effect probably damaging
Transcript: ENSMUST00000043208
AA Change: V766D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000036150
Gene: ENSMUSG00000034460
AA Change: V766D

DomainStartEndE-ValueType
low complexity region 36 56 N/A INTRINSIC
low complexity region 57 80 N/A INTRINSIC
low complexity region 89 98 N/A INTRINSIC
Pfam:SIX1_SD 101 211 1.6e-47 PFAM
HOX 216 278 7.48e-17 SMART
low complexity region 335 348 N/A INTRINSIC
low complexity region 365 378 N/A INTRINSIC
low complexity region 424 437 N/A INTRINSIC
low complexity region 587 598 N/A INTRINSIC
low complexity region 616 629 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000175693
SMART Domains Protein: ENSMUSP00000135699
Gene: ENSMUSG00000034460

DomainStartEndE-ValueType
low complexity region 28 48 N/A INTRINSIC
low complexity region 49 72 N/A INTRINSIC
low complexity region 81 90 N/A INTRINSIC
HOX 208 270 7.48e-17 SMART
low complexity region 327 340 N/A INTRINSIC
low complexity region 357 370 N/A INTRINSIC
low complexity region 416 429 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the homeobox family, subfamily SIX. The drosophila homolog is a nuclear homeoprotein required for eye development. Studies in mouse show that this gene product functions as a transcription factor, and may have a role in the differentiation or maturation of neuronal cells. [provided by RefSeq, May 2010]
PHENOTYPE: Homozygotes for a targeted null mutation are viable, fertile, and exhibit no apparent abnormalities suggesting compensation by other Six family members. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130019O22Rik T C 7: 127,385,042 probably benign Het
Acacb G A 5: 114,228,591 E1565K probably damaging Het
Amy1 T C 3: 113,569,509 N63S probably damaging Het
Arhgef15 G T 11: 68,947,796 N591K probably damaging Het
AW551984 A G 9: 39,600,614 S34P probably damaging Het
C2cd3 A G 7: 100,432,091 D127G probably damaging Het
Ccdc87 T A 19: 4,841,235 V585E probably benign Het
Cul2 T C 18: 3,421,345 I223T probably damaging Het
Dgkq C T 5: 108,653,708 V495M probably damaging Het
Dpp10 A G 1: 123,367,601 I570T possibly damaging Het
Dstyk C T 1: 132,449,804 Q383* probably null Het
Emilin2 C A 17: 71,310,956 probably benign Het
Fnip1 A G 11: 54,515,567 I1163M probably damaging Het
Fryl C T 5: 73,090,751 E1008K possibly damaging Het
Gm15448 A T 7: 3,822,346 H432Q possibly damaging Het
Gm35315 A T 5: 110,078,659 Y305N possibly damaging Het
Grhl3 T A 4: 135,557,196 D195V probably damaging Het
Il33 T C 19: 29,952,000 F41S probably benign Het
Il4 A G 11: 53,613,909 S15P possibly damaging Het
Inf2 C T 12: 112,604,256 P410S probably benign Het
Kalrn T A 16: 34,332,164 D349V possibly damaging Het
Krt4 A G 15: 101,922,794 M224T probably benign Het
Lrp2 C T 2: 69,461,287 S3516N probably damaging Het
Macf1 A T 4: 123,401,594 probably null Het
Msr1 G A 8: 39,615,817 P213S probably damaging Het
Nptx1 G T 11: 119,544,721 C256* probably null Het
Nr1d1 T C 11: 98,772,014 Y51C probably damaging Het
Olfr1205 G A 2: 88,831,525 R136Q probably benign Het
Panx3 T C 9: 37,661,165 D363G probably damaging Het
Prkag1 A G 15: 98,814,523 F143L probably damaging Het
Ptger4 T C 15: 5,242,997 K72R possibly damaging Het
Pvrig A G 5: 138,342,050 T28A probably benign Het
Rhod C T 19: 4,426,105 C206Y probably benign Het
Rngtt C A 4: 33,320,606 S51* probably null Het
Rreb1 T G 13: 37,932,129 S1155A probably benign Het
Scn9a A C 2: 66,526,963 I998S possibly damaging Het
Sfmbt1 T A 14: 30,773,911 F50L probably damaging Het
Smpd1 T C 7: 105,556,928 I421T probably damaging Het
Son T A 16: 91,658,166 M1267K probably benign Het
Styk1 T A 6: 131,310,064 D156V possibly damaging Het
Supt3 A G 17: 45,119,143 E361G probably benign Het
Tbx3 T A 5: 119,674,191 Y185* probably null Het
Tmem2 T C 19: 21,801,908 C361R probably benign Het
Trpm1 A T 7: 64,268,504 T531S probably benign Het
Tspan32 T A 7: 143,018,742 W172R possibly damaging Het
Ttc26 T A 6: 38,398,313 S250T possibly damaging Het
Urb1 A T 16: 90,762,430 probably null Het
Vmn2r70 T A 7: 85,559,068 I734F probably damaging Het
Vwa7 A G 17: 35,024,199 T618A probably benign Het
Wac T A 18: 7,920,163 V339E probably damaging Het
Wrn G A 8: 33,342,996 T156M probably damaging Het
Zeb1 T A 18: 5,770,498 C884S probably damaging Het
Zmpste24 A G 4: 121,095,670 V10A probably damaging Het
Other mutations in Six4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01635:Six4 APN 12 73109197 missense probably benign 0.32
IGL02045:Six4 APN 12 73108655 missense probably benign 0.04
IGL02678:Six4 APN 12 73112634 missense probably damaging 1.00
R2473:Six4 UTSW 12 73104175 missense probably benign 0.00
R3409:Six4 UTSW 12 73112883 missense probably damaging 0.98
R3410:Six4 UTSW 12 73112883 missense probably damaging 0.98
R3411:Six4 UTSW 12 73112883 missense probably damaging 0.98
R4175:Six4 UTSW 12 73108831 missense probably damaging 1.00
R4176:Six4 UTSW 12 73108831 missense probably damaging 1.00
R4296:Six4 UTSW 12 73104125 missense probably damaging 1.00
R4303:Six4 UTSW 12 73112540 missense possibly damaging 0.91
R5013:Six4 UTSW 12 73103626 missense probably benign 0.37
R5782:Six4 UTSW 12 73104058 missense probably benign 0.02
R5794:Six4 UTSW 12 73112350 missense possibly damaging 0.82
R6650:Six4 UTSW 12 73103525 missense probably benign 0.04
R7018:Six4 UTSW 12 73108953 missense probably benign 0.01
R7464:Six4 UTSW 12 73112530 missense possibly damaging 0.89
R7832:Six4 UTSW 12 73112634 missense probably damaging 1.00
R7871:Six4 UTSW 12 73104239 critical splice acceptor site probably benign
R7872:Six4 UTSW 12 73104239 critical splice acceptor site probably benign
R7873:Six4 UTSW 12 73104239 critical splice acceptor site probably benign
R7915:Six4 UTSW 12 73112634 missense probably damaging 1.00
R7954:Six4 UTSW 12 73104239 critical splice acceptor site probably benign
R7955:Six4 UTSW 12 73104239 critical splice acceptor site probably benign
R7956:Six4 UTSW 12 73104239 critical splice acceptor site probably benign
RF012:Six4 UTSW 12 73103582 frame shift probably null
RF013:Six4 UTSW 12 73103582 frame shift probably null
RF014:Six4 UTSW 12 73103582 frame shift probably null
RF015:Six4 UTSW 12 73103582 frame shift probably null
Predicted Primers PCR Primer
(F):5'- AAAGCGAGCACGATGTGACC -3'
(R):5'- GTTCTGCAGTCAGTCCCTAAC -3'

Sequencing Primer
(F):5'- GCTCTTCATGCAGCCCAAG -3'
(R):5'- TCTGCAGTCAGTCCCTAACATAAAAG -3'
Posted On2018-05-24