Incidental Mutation 'R6429:Prkag1'
ID 518447
Institutional Source Beutler Lab
Gene Symbol Prkag1
Ensembl Gene ENSMUSG00000067713
Gene Name protein kinase, AMP-activated, gamma 1 non-catalytic subunit
Synonyms Prkaac
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.450) question?
Stock # R6429 (G1)
Quality Score 225.009
Status Not validated
Chromosome 15
Chromosomal Location 98812797-98831521 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 98814523 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 143 (F143L)
Ref Sequence ENSEMBL: ENSMUSP00000155433 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168846] [ENSMUST00000229297] [ENSMUST00000230560]
AlphaFold O54950
Predicted Effect probably damaging
Transcript: ENSMUST00000168846
AA Change: F174L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000132499
Gene: ENSMUSG00000067713
AA Change: F174L

DomainStartEndE-ValueType
CBS 46 95 8.18e-7 SMART
CBS 127 176 3.12e-12 SMART
CBS 202 250 1.01e-11 SMART
CBS 274 322 2.11e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181510
Predicted Effect probably benign
Transcript: ENSMUST00000229297
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229346
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229544
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229573
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230113
Predicted Effect probably damaging
Transcript: ENSMUST00000230560
AA Change: F143L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a regulatory subunit of the AMP-activated protein kinase (AMPK). AMPK is a heterotrimer consisting of an alpha catalytic subunit, and non-catalytic beta and gamma subunits. AMPK is an important energy-sensing enzyme that monitors cellular energy status. In response to cellular metabolic stresses, AMPK is activated, and thus phosphorylates and inactivates acetyl-CoA carboxylase (ACC) and beta-hydroxy beta-methylglutaryl-CoA reductase (HMGCR), key enzymes involved in regulating de novo biosynthesis of fatty acid and cholesterol. This subunit is one of the gamma regulatory subunits of AMPK. Alternatively spliced transcript variants encoding distinct isoforms have been observed. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit hemolytic anemia, extramedullary hematopoiesis, and iron accumulation in the spleen, liver, and Kupffer cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130019O22Rik T C 7: 127,385,042 probably benign Het
Acacb G A 5: 114,228,591 E1565K probably damaging Het
Amy1 T C 3: 113,569,509 N63S probably damaging Het
Arhgef15 G T 11: 68,947,796 N591K probably damaging Het
AW551984 A G 9: 39,600,614 S34P probably damaging Het
C2cd3 A G 7: 100,432,091 D127G probably damaging Het
Ccdc87 T A 19: 4,841,235 V585E probably benign Het
Cul2 T C 18: 3,421,345 I223T probably damaging Het
Dgkq C T 5: 108,653,708 V495M probably damaging Het
Dpp10 A G 1: 123,367,601 I570T possibly damaging Het
Dstyk C T 1: 132,449,804 Q383* probably null Het
Emilin2 C A 17: 71,310,956 probably benign Het
Fnip1 A G 11: 54,515,567 I1163M probably damaging Het
Fryl C T 5: 73,090,751 E1008K possibly damaging Het
Gm15448 A T 7: 3,822,346 H432Q possibly damaging Het
Gm35315 A T 5: 110,078,659 Y305N possibly damaging Het
Grhl3 T A 4: 135,557,196 D195V probably damaging Het
Il33 T C 19: 29,952,000 F41S probably benign Het
Il4 A G 11: 53,613,909 S15P possibly damaging Het
Inf2 C T 12: 112,604,256 P410S probably benign Het
Kalrn T A 16: 34,332,164 D349V possibly damaging Het
Krt4 A G 15: 101,922,794 M224T probably benign Het
Lrp2 C T 2: 69,461,287 S3516N probably damaging Het
Macf1 A T 4: 123,401,594 probably null Het
Msr1 G A 8: 39,615,817 P213S probably damaging Het
Nptx1 G T 11: 119,544,721 C256* probably null Het
Nr1d1 T C 11: 98,772,014 Y51C probably damaging Het
Olfr1205 G A 2: 88,831,525 R136Q probably benign Het
Panx3 T C 9: 37,661,165 D363G probably damaging Het
Ptger4 T C 15: 5,242,997 K72R possibly damaging Het
Pvrig A G 5: 138,342,050 T28A probably benign Het
Rhod C T 19: 4,426,105 C206Y probably benign Het
Rngtt C A 4: 33,320,606 S51* probably null Het
Rreb1 T G 13: 37,932,129 S1155A probably benign Het
Scn9a A C 2: 66,526,963 I998S possibly damaging Het
Sfmbt1 T A 14: 30,773,911 F50L probably damaging Het
Six4 A T 12: 73,103,473 V766D probably damaging Het
Smpd1 T C 7: 105,556,928 I421T probably damaging Het
Son T A 16: 91,658,166 M1267K probably benign Het
Styk1 T A 6: 131,310,064 D156V possibly damaging Het
Supt3 A G 17: 45,119,143 E361G probably benign Het
Tbx3 T A 5: 119,674,191 Y185* probably null Het
Tmem2 T C 19: 21,801,908 C361R probably benign Het
Trpm1 A T 7: 64,268,504 T531S probably benign Het
Tspan32 T A 7: 143,018,742 W172R possibly damaging Het
Ttc26 T A 6: 38,398,313 S250T possibly damaging Het
Urb1 A T 16: 90,762,430 probably null Het
Vmn2r70 T A 7: 85,559,068 I734F probably damaging Het
Vwa7 A G 17: 35,024,199 T618A probably benign Het
Wac T A 18: 7,920,163 V339E probably damaging Het
Wrn G A 8: 33,342,996 T156M probably damaging Het
Zeb1 T A 18: 5,770,498 C884S probably damaging Het
Zmpste24 A G 4: 121,095,670 V10A probably damaging Het
Other mutations in Prkag1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01932:Prkag1 APN 15 98814531 missense probably damaging 1.00
IGL02621:Prkag1 APN 15 98814028 missense probably damaging 1.00
IGL02804:Prkag1 APN 15 98815504 missense probably damaging 1.00
IGL03197:Prkag1 APN 15 98815177 splice site probably benign
R0328:Prkag1 UTSW 15 98815682 missense probably damaging 1.00
R1188:Prkag1 UTSW 15 98814598 missense probably damaging 0.99
R1493:Prkag1 UTSW 15 98813670 missense probably benign 0.02
R1663:Prkag1 UTSW 15 98815895 missense probably damaging 1.00
R2115:Prkag1 UTSW 15 98814552 missense probably damaging 1.00
R2216:Prkag1 UTSW 15 98815946 start codon destroyed probably null 1.00
R5037:Prkag1 UTSW 15 98815887 missense possibly damaging 0.51
R5175:Prkag1 UTSW 15 98815715 missense possibly damaging 0.82
R5597:Prkag1 UTSW 15 98815908 missense probably damaging 1.00
R6185:Prkag1 UTSW 15 98825714 missense probably benign 0.00
R6359:Prkag1 UTSW 15 98814552 missense probably damaging 1.00
R7777:Prkag1 UTSW 15 98814597 missense probably damaging 1.00
R8432:Prkag1 UTSW 15 98815544 missense possibly damaging 0.71
R8922:Prkag1 UTSW 15 98814266 missense probably benign
R9163:Prkag1 UTSW 15 98814019 missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- TTAGACATGAATTCCGGCTTGG -3'
(R):5'- CTGACTGTAAACACATTCCAAGGG -3'

Sequencing Primer
(F):5'- CATGAATTCCGGCTTGGGGAAC -3'
(R):5'- CACATTCCAAGGGGTTGTACAGC -3'
Posted On 2018-05-24