Incidental Mutation 'R6429:Cul2'
ID 518455
Institutional Source Beutler Lab
Gene Symbol Cul2
Ensembl Gene ENSMUSG00000024231
Gene Name cullin 2
Synonyms 4932411N15Rik, 1300003D18Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.957) question?
Stock # R6429 (G1)
Quality Score 225.009
Status Not validated
Chromosome 18
Chromosomal Location 3382988-3436377 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 3421345 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 223 (I223T)
Ref Sequence ENSEMBL: ENSMUSP00000123903 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025073] [ENSMUST00000080089] [ENSMUST00000161317] [ENSMUST00000162301]
AlphaFold Q9D4H8
Predicted Effect possibly damaging
Transcript: ENSMUST00000025073
AA Change: I286T

PolyPhen 2 Score 0.939 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000025073
Gene: ENSMUSG00000024231
AA Change: I286T

DomainStartEndE-ValueType
SCOP:d1ldja2 11 386 1e-109 SMART
CULLIN 416 568 1.19e-84 SMART
low complexity region 636 646 N/A INTRINSIC
Pfam:Cullin_Nedd8 651 700 9.2e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000080089
SMART Domains Protein: ENSMUSP00000078988
Gene: ENSMUSG00000024231

DomainStartEndE-ValueType
Pfam:Cullin 14 88 2.1e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000161317
AA Change: I223T

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000123903
Gene: ENSMUSG00000024231
AA Change: I223T

DomainStartEndE-ValueType
CULLIN 353 505 1.19e-84 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161852
Predicted Effect possibly damaging
Transcript: ENSMUST00000162301
AA Change: I286T

PolyPhen 2 Score 0.939 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000125403
Gene: ENSMUSG00000024231
AA Change: I286T

DomainStartEndE-ValueType
SCOP:d1ldja2 11 386 1e-108 SMART
CULLIN 416 568 1.19e-84 SMART
low complexity region 636 646 N/A INTRINSIC
Cullin_Nedd8 672 739 1.01e-33 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130019O22Rik T C 7: 127,385,042 probably benign Het
Acacb G A 5: 114,228,591 E1565K probably damaging Het
Amy1 T C 3: 113,569,509 N63S probably damaging Het
Arhgef15 G T 11: 68,947,796 N591K probably damaging Het
AW551984 A G 9: 39,600,614 S34P probably damaging Het
C2cd3 A G 7: 100,432,091 D127G probably damaging Het
Ccdc87 T A 19: 4,841,235 V585E probably benign Het
Dgkq C T 5: 108,653,708 V495M probably damaging Het
Dpp10 A G 1: 123,367,601 I570T possibly damaging Het
Dstyk C T 1: 132,449,804 Q383* probably null Het
Emilin2 C A 17: 71,310,956 probably benign Het
Fnip1 A G 11: 54,515,567 I1163M probably damaging Het
Fryl C T 5: 73,090,751 E1008K possibly damaging Het
Gm15448 A T 7: 3,822,346 H432Q possibly damaging Het
Gm35315 A T 5: 110,078,659 Y305N possibly damaging Het
Grhl3 T A 4: 135,557,196 D195V probably damaging Het
Il33 T C 19: 29,952,000 F41S probably benign Het
Il4 A G 11: 53,613,909 S15P possibly damaging Het
Inf2 C T 12: 112,604,256 P410S probably benign Het
Kalrn T A 16: 34,332,164 D349V possibly damaging Het
Krt4 A G 15: 101,922,794 M224T probably benign Het
Lrp2 C T 2: 69,461,287 S3516N probably damaging Het
Macf1 A T 4: 123,401,594 probably null Het
Msr1 G A 8: 39,615,817 P213S probably damaging Het
Nptx1 G T 11: 119,544,721 C256* probably null Het
Nr1d1 T C 11: 98,772,014 Y51C probably damaging Het
Olfr1205 G A 2: 88,831,525 R136Q probably benign Het
Panx3 T C 9: 37,661,165 D363G probably damaging Het
Prkag1 A G 15: 98,814,523 F143L probably damaging Het
Ptger4 T C 15: 5,242,997 K72R possibly damaging Het
Pvrig A G 5: 138,342,050 T28A probably benign Het
Rhod C T 19: 4,426,105 C206Y probably benign Het
Rngtt C A 4: 33,320,606 S51* probably null Het
Rreb1 T G 13: 37,932,129 S1155A probably benign Het
Scn9a A C 2: 66,526,963 I998S possibly damaging Het
Sfmbt1 T A 14: 30,773,911 F50L probably damaging Het
Six4 A T 12: 73,103,473 V766D probably damaging Het
Smpd1 T C 7: 105,556,928 I421T probably damaging Het
Son T A 16: 91,658,166 M1267K probably benign Het
Styk1 T A 6: 131,310,064 D156V possibly damaging Het
Supt3 A G 17: 45,119,143 E361G probably benign Het
Tbx3 T A 5: 119,674,191 Y185* probably null Het
Tmem2 T C 19: 21,801,908 C361R probably benign Het
Trpm1 A T 7: 64,268,504 T531S probably benign Het
Tspan32 T A 7: 143,018,742 W172R possibly damaging Het
Ttc26 T A 6: 38,398,313 S250T possibly damaging Het
Urb1 A T 16: 90,762,430 probably null Het
Vmn2r70 T A 7: 85,559,068 I734F probably damaging Het
Vwa7 A G 17: 35,024,199 T618A probably benign Het
Wac T A 18: 7,920,163 V339E probably damaging Het
Wrn G A 8: 33,342,996 T156M probably damaging Het
Zeb1 T A 18: 5,770,498 C884S probably damaging Het
Zmpste24 A G 4: 121,095,670 V10A probably damaging Het
Other mutations in Cul2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00704:Cul2 APN 18 3423487 missense probably benign
IGL01293:Cul2 APN 18 3419426 missense probably damaging 0.99
IGL02719:Cul2 APN 18 3434052 missense probably damaging 1.00
IGL02886:Cul2 APN 18 3426920 splice site probably benign
IGL03190:Cul2 APN 18 3429634 missense possibly damaging 0.95
IGL03389:Cul2 APN 18 3431029 missense probably benign 0.00
IGL03409:Cul2 APN 18 3429593 missense probably damaging 1.00
R0238:Cul2 UTSW 18 3414115 splice site probably benign
R1013:Cul2 UTSW 18 3425535 nonsense probably null
R1119:Cul2 UTSW 18 3419335 splice site probably benign
R1743:Cul2 UTSW 18 3426851 missense probably damaging 1.00
R1897:Cul2 UTSW 18 3414164 missense probably benign
R2252:Cul2 UTSW 18 3399876 missense probably damaging 1.00
R2253:Cul2 UTSW 18 3399876 missense probably damaging 1.00
R3898:Cul2 UTSW 18 3434033 missense probably benign 0.07
R4386:Cul2 UTSW 18 3434856 missense probably damaging 1.00
R4579:Cul2 UTSW 18 3430957 missense probably benign 0.00
R4828:Cul2 UTSW 18 3431013 missense probably damaging 1.00
R6085:Cul2 UTSW 18 3431508 missense probably benign 0.01
R6480:Cul2 UTSW 18 3417561 missense possibly damaging 0.89
R6805:Cul2 UTSW 18 3421263 missense probably damaging 1.00
R6825:Cul2 UTSW 18 3434946 missense probably damaging 0.99
R7343:Cul2 UTSW 18 3426873 missense probably benign 0.08
R7690:Cul2 UTSW 18 3419420 missense probably benign 0.09
R8114:Cul2 UTSW 18 3426164 nonsense probably null
R8414:Cul2 UTSW 18 3399912 missense probably benign 0.08
R8736:Cul2 UTSW 18 3434019 missense probably damaging 0.99
R8849:Cul2 UTSW 18 3423551 missense probably benign 0.00
R9199:Cul2 UTSW 18 3423577 missense probably benign 0.00
R9443:Cul2 UTSW 18 3434041 nonsense probably null
X0067:Cul2 UTSW 18 3419435 missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- GCTGGCTGATGTTAAACATTGC -3'
(R):5'- TGCATAGAAGGAAAGTAGCCTTTG -3'

Sequencing Primer
(F):5'- GGCTGATGTTAAACATTGCATCATAG -3'
(R):5'- CACCAGGGGGTATTAAAGT -3'
Posted On 2018-05-24