Incidental Mutation 'R6429:Cul2'
ID 518455
Institutional Source Beutler Lab
Gene Symbol Cul2
Ensembl Gene ENSMUSG00000024231
Gene Name cullin 2
Synonyms 4932411N15Rik, 1300003D18Rik
MMRRC Submission 044567-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.941) question?
Stock # R6429 (G1)
Quality Score 225.009
Status Not validated
Chromosome 18
Chromosomal Location 3382988-3436377 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 3421345 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 223 (I223T)
Ref Sequence ENSEMBL: ENSMUSP00000123903 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025073] [ENSMUST00000080089] [ENSMUST00000161317] [ENSMUST00000162301]
AlphaFold Q9D4H8
Predicted Effect possibly damaging
Transcript: ENSMUST00000025073
AA Change: I286T

PolyPhen 2 Score 0.939 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000025073
Gene: ENSMUSG00000024231
AA Change: I286T

DomainStartEndE-ValueType
SCOP:d1ldja2 11 386 1e-109 SMART
CULLIN 416 568 1.19e-84 SMART
low complexity region 636 646 N/A INTRINSIC
Pfam:Cullin_Nedd8 651 700 9.2e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000080089
SMART Domains Protein: ENSMUSP00000078988
Gene: ENSMUSG00000024231

DomainStartEndE-ValueType
Pfam:Cullin 14 88 2.1e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000161317
AA Change: I223T

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000123903
Gene: ENSMUSG00000024231
AA Change: I223T

DomainStartEndE-ValueType
CULLIN 353 505 1.19e-84 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161852
Predicted Effect possibly damaging
Transcript: ENSMUST00000162301
AA Change: I286T

PolyPhen 2 Score 0.939 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000125403
Gene: ENSMUSG00000024231
AA Change: I286T

DomainStartEndE-ValueType
SCOP:d1ldja2 11 386 1e-108 SMART
CULLIN 416 568 1.19e-84 SMART
low complexity region 636 646 N/A INTRINSIC
Cullin_Nedd8 672 739 1.01e-33 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acacb G A 5: 114,366,652 (GRCm39) E1565K probably damaging Het
Amy1 T C 3: 113,363,158 (GRCm39) N63S probably damaging Het
Arhgef15 G T 11: 68,838,622 (GRCm39) N591K probably damaging Het
AW551984 A G 9: 39,511,910 (GRCm39) S34P probably damaging Het
C2cd3 A G 7: 100,081,298 (GRCm39) D127G probably damaging Het
Ccdc87 T A 19: 4,891,263 (GRCm39) V585E probably benign Het
Cemip2 T C 19: 21,779,272 (GRCm39) C361R probably benign Het
Dgkq C T 5: 108,801,574 (GRCm39) V495M probably damaging Het
Dpp10 A G 1: 123,295,330 (GRCm39) I570T possibly damaging Het
Dstyk C T 1: 132,377,542 (GRCm39) Q383* probably null Het
Emilin2 C A 17: 71,617,951 (GRCm39) probably benign Het
Fnip1 A G 11: 54,406,393 (GRCm39) I1163M probably damaging Het
Fryl C T 5: 73,248,094 (GRCm39) E1008K possibly damaging Het
Gm35315 A T 5: 110,226,525 (GRCm39) Y305N possibly damaging Het
Grhl3 T A 4: 135,284,507 (GRCm39) D195V probably damaging Het
Ift56 T A 6: 38,375,248 (GRCm39) S250T possibly damaging Het
Il33 T C 19: 29,929,400 (GRCm39) F41S probably benign Het
Il4 A G 11: 53,504,736 (GRCm39) S15P possibly damaging Het
Inf2 C T 12: 112,570,690 (GRCm39) P410S probably benign Het
Kalrn T A 16: 34,152,534 (GRCm39) D349V possibly damaging Het
Krt4 A G 15: 101,831,229 (GRCm39) M224T probably benign Het
Lrp2 C T 2: 69,291,631 (GRCm39) S3516N probably damaging Het
Macf1 A T 4: 123,295,387 (GRCm39) probably null Het
Msr1 G A 8: 40,068,858 (GRCm39) P213S probably damaging Het
Nptx1 G T 11: 119,435,547 (GRCm39) C256* probably null Het
Nr1d1 T C 11: 98,662,840 (GRCm39) Y51C probably damaging Het
Or4c11c G A 2: 88,661,869 (GRCm39) R136Q probably benign Het
Panx3 T C 9: 37,572,461 (GRCm39) D363G probably damaging Het
Pira13 A T 7: 3,825,345 (GRCm39) H432Q possibly damaging Het
Prkag1 A G 15: 98,712,404 (GRCm39) F143L probably damaging Het
Ptger4 T C 15: 5,272,478 (GRCm39) K72R possibly damaging Het
Pvrig-ps A G 5: 138,340,312 (GRCm39) T28A probably benign Het
Rhod C T 19: 4,476,133 (GRCm39) C206Y probably benign Het
Rngtt C A 4: 33,320,606 (GRCm39) S51* probably null Het
Rreb1 T G 13: 38,116,105 (GRCm39) S1155A probably benign Het
Scn9a A C 2: 66,357,307 (GRCm39) I998S possibly damaging Het
Sfmbt1 T A 14: 30,495,868 (GRCm39) F50L probably damaging Het
Six4 A T 12: 73,150,247 (GRCm39) V766D probably damaging Het
Smpd1 T C 7: 105,206,135 (GRCm39) I421T probably damaging Het
Son T A 16: 91,455,054 (GRCm39) M1267K probably benign Het
Styk1 T A 6: 131,287,027 (GRCm39) D156V possibly damaging Het
Supt3 A G 17: 45,430,030 (GRCm39) E361G probably benign Het
Tbx3 T A 5: 119,812,256 (GRCm39) Y185* probably null Het
Trpm1 A T 7: 63,918,252 (GRCm39) T531S probably benign Het
Tspan32 T A 7: 142,572,479 (GRCm39) W172R possibly damaging Het
Urb1 A T 16: 90,559,318 (GRCm39) probably null Het
Vmn2r70 T A 7: 85,208,276 (GRCm39) I734F probably damaging Het
Vwa7 A G 17: 35,243,175 (GRCm39) T618A probably benign Het
Wac T A 18: 7,920,163 (GRCm39) V339E probably damaging Het
Wrn G A 8: 33,833,024 (GRCm39) T156M probably damaging Het
Zeb1 T A 18: 5,770,498 (GRCm39) C884S probably damaging Het
Zfp747l1 T C 7: 126,984,214 (GRCm39) probably benign Het
Zmpste24 A G 4: 120,952,867 (GRCm39) V10A probably damaging Het
Other mutations in Cul2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00704:Cul2 APN 18 3,423,487 (GRCm39) missense probably benign
IGL01293:Cul2 APN 18 3,419,426 (GRCm39) missense probably damaging 0.99
IGL02719:Cul2 APN 18 3,434,052 (GRCm39) missense probably damaging 1.00
IGL02886:Cul2 APN 18 3,426,920 (GRCm39) splice site probably benign
IGL03190:Cul2 APN 18 3,429,634 (GRCm39) missense possibly damaging 0.95
IGL03389:Cul2 APN 18 3,431,029 (GRCm39) missense probably benign 0.00
IGL03409:Cul2 APN 18 3,429,593 (GRCm39) missense probably damaging 1.00
R0238:Cul2 UTSW 18 3,414,115 (GRCm39) splice site probably benign
R1013:Cul2 UTSW 18 3,425,535 (GRCm39) nonsense probably null
R1119:Cul2 UTSW 18 3,419,335 (GRCm39) splice site probably benign
R1743:Cul2 UTSW 18 3,426,851 (GRCm39) missense probably damaging 1.00
R1897:Cul2 UTSW 18 3,414,164 (GRCm39) missense probably benign
R2252:Cul2 UTSW 18 3,399,876 (GRCm39) missense probably damaging 1.00
R2253:Cul2 UTSW 18 3,399,876 (GRCm39) missense probably damaging 1.00
R3898:Cul2 UTSW 18 3,434,033 (GRCm39) missense probably benign 0.07
R4386:Cul2 UTSW 18 3,434,856 (GRCm39) missense probably damaging 1.00
R4579:Cul2 UTSW 18 3,430,957 (GRCm39) missense probably benign 0.00
R4828:Cul2 UTSW 18 3,431,013 (GRCm39) missense probably damaging 1.00
R6085:Cul2 UTSW 18 3,431,508 (GRCm39) missense probably benign 0.01
R6480:Cul2 UTSW 18 3,417,561 (GRCm39) missense possibly damaging 0.89
R6805:Cul2 UTSW 18 3,421,263 (GRCm39) missense probably damaging 1.00
R6825:Cul2 UTSW 18 3,434,946 (GRCm39) missense probably damaging 0.99
R7343:Cul2 UTSW 18 3,426,873 (GRCm39) missense probably benign 0.08
R7690:Cul2 UTSW 18 3,419,420 (GRCm39) missense probably benign 0.09
R8114:Cul2 UTSW 18 3,426,164 (GRCm39) nonsense probably null
R8414:Cul2 UTSW 18 3,399,912 (GRCm39) missense probably benign 0.08
R8736:Cul2 UTSW 18 3,434,019 (GRCm39) missense probably damaging 0.99
R8849:Cul2 UTSW 18 3,423,551 (GRCm39) missense probably benign 0.00
R9199:Cul2 UTSW 18 3,423,577 (GRCm39) missense probably benign 0.00
R9443:Cul2 UTSW 18 3,434,041 (GRCm39) nonsense probably null
R9709:Cul2 UTSW 18 3,431,560 (GRCm39) missense probably damaging 1.00
X0067:Cul2 UTSW 18 3,419,435 (GRCm39) missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- GCTGGCTGATGTTAAACATTGC -3'
(R):5'- TGCATAGAAGGAAAGTAGCCTTTG -3'

Sequencing Primer
(F):5'- GGCTGATGTTAAACATTGCATCATAG -3'
(R):5'- CACCAGGGGGTATTAAAGT -3'
Posted On 2018-05-24