Mutagenetix > Incidental Mutation

Incidental Mutation 'R6429:Zeb1'

518456

Institutional Source

Beutler Lab

Gene Symbol

Zeb1

Ensembl Gene

ENSMUSG00000024238

Gene Name

zinc finger E-box binding homeobox 1

Synonyms

3110032K11Rik, Tw, MEB1, Zfhx1a, Zfhep, ZEB, AREB6, Zfx1a, Tcf18, Nil2, Tcf8, [delta]EF1

MMRRC Submission

Accession Numbers

Genbank: NM_011546; MGI: 1344313

Essential gene?

Probably essential (E-score: 0.956) question?

Stock #

R6429 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

5591860-5775467 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 5770498 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Serine at position 884 (C884S)

Ref Sequence

ENSEMBL: ENSMUSP00000025081 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000025081] [ENSMUST00000159390] [ENSMUST00000175925]

AlphaFold

Q64318

Predicted Effect

probably damaging
Transcript: ENSMUST00000025081
AA Change: C884S

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000025081
Gene: ENSMUSG00000024238
AA Change: C884S

Domain	Start	End	E-Value	Type
low complexity region	13	30	N/A	INTRINSIC
ZnF_C2H2	150	173	3.16e-3	SMART
ZnF_C2H2	180	202	3.21e-4	SMART
ZnF_C2H2	220	242	4.87e-4	SMART
ZnF_C2H2	248	268	1.86e1	SMART
low complexity region	288	304	N/A	INTRINSIC
low complexity region	532	555	N/A	INTRINSIC
HOX	559	621	7.53e-3	SMART
low complexity region	730	742	N/A	INTRINSIC
low complexity region	766	783	N/A	INTRINSIC
ZnF_C2H2	882	904	1.18e-2	SMART
ZnF_C2H2	910	932	4.4e-2	SMART
ZnF_C2H2	938	959	1.89e-1	SMART
coiled coil region	1006	1077	N/A	INTRINSIC
low complexity region	1096	1112	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000159390

SMART Domains

Protein: ENSMUSP00000124395
Gene: ENSMUSG00000024238

Domain	Start	End	E-Value	Type
low complexity region	13	30	N/A	INTRINSIC
ZnF_C2H2	96	119	3.16e-3	SMART
ZnF_C2H2	126	148	3.21e-4	SMART
ZnF_C2H2	166	188	4.87e-4	SMART
ZnF_C2H2	194	214	1.86e1	SMART
low complexity region	234	250	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000161295

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000162892

SMART Domains

Protein: ENSMUSP00000124677
Gene: ENSMUSG00000024238

Domain	Start	End	E-Value	Type
ZnF_C2H2	94	117	1.3e-5	SMART
ZnF_C2H2	124	146	1.3e-6	SMART
ZnF_C2H2	164	186	2e-6	SMART
ZnF_C2H2	192	212	7.8e-2	SMART
low complexity region	232	248	N/A	INTRINSIC
low complexity region	476	499	N/A	INTRINSIC
HOX	503	565	3.9e-5	SMART
low complexity region	674	686	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000175925

SMART Domains

Protein: ENSMUSP00000135125
Gene: ENSMUSG00000024238

Domain	Start	End	E-Value	Type
ZnF_C2H2	130	153	3.16e-3	SMART
ZnF_C2H2	160	182	3.21e-4	SMART
ZnF_C2H2	200	222	4.87e-4	SMART
ZnF_C2H2	228	248	1.86e1	SMART
low complexity region	268	284	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000177030

SMART Domains

Protein: ENSMUSP00000135865
Gene: ENSMUSG00000024238

Domain	Start	End	E-Value	Type
ZnF_C2H2	22	44	4.87e-4	SMART
low complexity region	277	300	N/A	INTRINSIC
HOX	304	366	7.53e-3	SMART
low complexity region	475	487	N/A	INTRINSIC
low complexity region	511	528	N/A	INTRINSIC
ZnF_C2H2	627	649	1.18e-2	SMART
ZnF_C2H2	655	677	4.4e-2	SMART
ZnF_C2H2	683	704	1.89e-1	SMART
low complexity region	758	775	N/A	INTRINSIC

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.6%
20x: 92.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a zinc finger transcription factor. The encoded protein likely plays a role in transcriptional repression of interleukin 2. Mutations in this gene have been associated with posterior polymorphous corneal dystrophy-3 and late-onset Fuchs endothelial corneal dystrophy. Alternatively spliced transcript variants encoding different isoforms have been described.[provided by RefSeq, Mar 2010]
PHENOTYPE: Mutations at this locus affect thymus organization and homozygotes exhibit severe thymic T cell deficiency. Some mutations result in eye anomalies and extensive skeletal abnormalities. Homozygotes generally die at birth due to respiratory failure. [provided by MGI curators]

Allele List at MGI

All alleles(6) : Targeted, knock-out(1) Targeted, other(1) Gene trapped(4)

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9130019O22Rik	T	C	7: 127,385,042		probably benign	Het
Acacb	G	A	5: 114,228,591	E1565K	probably damaging	Het
Amy1	T	C	3: 113,569,509	N63S	probably damaging	Het
Arhgef15	G	T	11: 68,947,796	N591K	probably damaging	Het
AW551984	A	G	9: 39,600,614	S34P	probably damaging	Het
C2cd3	A	G	7: 100,432,091	D127G	probably damaging	Het
Ccdc87	T	A	19: 4,841,235	V585E	probably benign	Het
Cul2	T	C	18: 3,421,345	I223T	probably damaging	Het
Dgkq	C	T	5: 108,653,708	V495M	probably damaging	Het
Dpp10	A	G	1: 123,367,601	I570T	possibly damaging	Het
Dstyk	C	T	1: 132,449,804	Q383*	probably null	Het
Emilin2	C	A	17: 71,310,956		probably benign	Het
Fnip1	A	G	11: 54,515,567	I1163M	probably damaging	Het
Fryl	C	T	5: 73,090,751	E1008K	possibly damaging	Het
Gm15448	A	T	7: 3,822,346	H432Q	possibly damaging	Het
Gm35315	A	T	5: 110,078,659	Y305N	possibly damaging	Het
Grhl3	T	A	4: 135,557,196	D195V	probably damaging	Het
Il33	T	C	19: 29,952,000	F41S	probably benign	Het
Il4	A	G	11: 53,613,909	S15P	possibly damaging	Het
Inf2	C	T	12: 112,604,256	P410S	probably benign	Het
Kalrn	T	A	16: 34,332,164	D349V	possibly damaging	Het
Krt4	A	G	15: 101,922,794	M224T	probably benign	Het
Lrp2	C	T	2: 69,461,287	S3516N	probably damaging	Het
Macf1	A	T	4: 123,401,594		probably null	Het
Msr1	G	A	8: 39,615,817	P213S	probably damaging	Het
Nptx1	G	T	11: 119,544,721	C256*	probably null	Het
Nr1d1	T	C	11: 98,772,014	Y51C	probably damaging	Het
Olfr1205	G	A	2: 88,831,525	R136Q	probably benign	Het
Panx3	T	C	9: 37,661,165	D363G	probably damaging	Het
Prkag1	A	G	15: 98,814,523	F143L	probably damaging	Het
Ptger4	T	C	15: 5,242,997	K72R	possibly damaging	Het
Pvrig	A	G	5: 138,342,050	T28A	probably benign	Het
Rhod	C	T	19: 4,426,105	C206Y	probably benign	Het
Rngtt	C	A	4: 33,320,606	S51*	probably null	Het
Rreb1	T	G	13: 37,932,129	S1155A	probably benign	Het
Scn9a	A	C	2: 66,526,963	I998S	possibly damaging	Het
Sfmbt1	T	A	14: 30,773,911	F50L	probably damaging	Het
Six4	A	T	12: 73,103,473	V766D	probably damaging	Het
Smpd1	T	C	7: 105,556,928	I421T	probably damaging	Het
Son	T	A	16: 91,658,166	M1267K	probably benign	Het
Styk1	T	A	6: 131,310,064	D156V	possibly damaging	Het
Supt3	A	G	17: 45,119,143	E361G	probably benign	Het
Tbx3	T	A	5: 119,674,191	Y185*	probably null	Het
Tmem2	T	C	19: 21,801,908	C361R	probably benign	Het
Trpm1	A	T	7: 64,268,504	T531S	probably benign	Het
Tspan32	T	A	7: 143,018,742	W172R	possibly damaging	Het
Ttc26	T	A	6: 38,398,313	S250T	possibly damaging	Het
Urb1	A	T	16: 90,762,430		probably null	Het
Vmn2r70	T	A	7: 85,559,068	I734F	probably damaging	Het
Vwa7	A	G	17: 35,024,199	T618A	probably benign	Het
Wac	T	A	18: 7,920,163	V339E	probably damaging	Het
Wrn	G	A	8: 33,342,996	T156M	probably damaging	Het
Zmpste24	A	G	4: 121,095,670	V10A	probably damaging	Het

Other mutations in Zeb1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00833:Zeb1	APN	18	5767774	missense	probably benign	0.00
IGL01139:Zeb1	APN	18	5705061	missense	possibly damaging	0.69
IGL01444:Zeb1	APN	18	5767906	missense	probably damaging	1.00
IGL01444:Zeb1	APN	18	5767138	missense	probably benign
IGL01806:Zeb1	APN	18	5767867	missense	possibly damaging	0.94
IGL01988:Zeb1	APN	18	5759037	nonsense	probably null
IGL02059:Zeb1	APN	18	5766892	missense	probably damaging	1.00
IGL03005:Zeb1	APN	18	5767150	missense	probably benign	0.03
IGL03153:Zeb1	APN	18	5770511	missense	probably damaging	1.00
Apes	UTSW	18	5761394	missense	probably damaging	1.00
cellophane	UTSW	18	5770554	nonsense	probably null
serpens	UTSW	18	5772455	missense	probably damaging	1.00
N/A - 293:Zeb1	UTSW	18	5767076	missense	possibly damaging	0.68
R0184:Zeb1	UTSW	18	5766808	missense	probably damaging	1.00
R0488:Zeb1	UTSW	18	5772455	missense	probably damaging	1.00
R0622:Zeb1	UTSW	18	5759123	nonsense	probably null
R0646:Zeb1	UTSW	18	5759027	missense	probably damaging	1.00
R0881:Zeb1	UTSW	18	5767138	missense	probably benign
R1251:Zeb1	UTSW	18	5705089	missense	probably damaging	1.00
R1257:Zeb1	UTSW	18	5772699	missense	possibly damaging	0.53
R1501:Zeb1	UTSW	18	5761399	missense	possibly damaging	0.95
R1547:Zeb1	UTSW	18	5767450	missense	possibly damaging	0.50
R1797:Zeb1	UTSW	18	5766298	nonsense	probably null
R1815:Zeb1	UTSW	18	5767898	missense	probably damaging	1.00
R2090:Zeb1	UTSW	18	5766458	missense	possibly damaging	0.65
R2129:Zeb1	UTSW	18	5767681	missense	possibly damaging	0.92
R2875:Zeb1	UTSW	18	5772859	small insertion	probably benign
R3888:Zeb1	UTSW	18	5748743	missense	probably damaging	1.00
R3941:Zeb1	UTSW	18	5767799	missense	probably benign	0.06
R3952:Zeb1	UTSW	18	5772716	missense	probably benign	0.17
R4271:Zeb1	UTSW	18	5758985	missense	probably damaging	0.99
R4512:Zeb1	UTSW	18	5759007	missense	probably damaging	1.00
R4514:Zeb1	UTSW	18	5759007	missense	probably damaging	1.00
R4677:Zeb1	UTSW	18	5766775	missense	probably damaging	0.97
R4729:Zeb1	UTSW	18	5767286	missense	probably damaging	1.00
R5839:Zeb1	UTSW	18	5767507	missense	probably benign
R5913:Zeb1	UTSW	18	5766765	missense	possibly damaging	0.49
R6248:Zeb1	UTSW	18	5766962	missense	probably damaging	1.00
R6354:Zeb1	UTSW	18	5772743	missense	possibly damaging	0.64
R6819:Zeb1	UTSW	18	5591917	missense	probably damaging	1.00
R7180:Zeb1	UTSW	18	5767867	missense	possibly damaging	0.94
R7193:Zeb1	UTSW	18	5772756	missense	probably damaging	0.98
R7199:Zeb1	UTSW	18	5767703	missense	probably benign	0.00
R7397:Zeb1	UTSW	18	5761394	missense	probably damaging	1.00
R7534:Zeb1	UTSW	18	5766611	missense	probably damaging	1.00
R7702:Zeb1	UTSW	18	5766802	missense	probably damaging	1.00
R7703:Zeb1	UTSW	18	5766917	missense	probably benign
R7934:Zeb1	UTSW	18	5748703	missense	probably benign	0.00
R8504:Zeb1	UTSW	18	5705127	missense	possibly damaging	0.94
R8539:Zeb1	UTSW	18	5748784	missense	probably damaging	0.99
R8716:Zeb1	UTSW	18	5767958	missense	probably damaging	0.99
R8772:Zeb1	UTSW	18	5770382	critical splice acceptor site	probably null
R8824:Zeb1	UTSW	18	5748680	splice site	probably benign
R9082:Zeb1	UTSW	18	5772557	missense	probably damaging	0.98
R9085:Zeb1	UTSW	18	5766716	missense	probably damaging	1.00
R9456:Zeb1	UTSW	18	5766709	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- GGAGGGCTTCACATCTAACATG -3'
(R):5'- GCTCCGCAGTAGGAATATGTG -3'

Sequencing Primer
(F):5'- GTAGATCCCAGGGATTCAACTCTG -3'
(R):5'- CTCCGCAGTAGGAATATGTGAAAAG -3'

Posted On

2018-05-24