Incidental Mutation 'R6430:Rabl6'
ID518469
Institutional Source Beutler Lab
Gene Symbol Rabl6
Ensembl Gene ENSMUSG00000015087
Gene NameRAB, member RAS oncogene family-like 6
SynonymsRbel1, Rbel1a, B230208H17Rik, Rbel1b
MMRRC Submission
Accession Numbers

Genbank: NM_001024616; MGI: 2442633

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6430 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location25583018-25608521 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 25584837 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 620 (N620K)
Ref Sequence ENSEMBL: ENSMUSP00000058746 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058137] [ENSMUST00000114217] [ENSMUST00000187017] [ENSMUST00000188161] [ENSMUST00000191602]
Predicted Effect probably damaging
Transcript: ENSMUST00000058137
AA Change: N620K

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000058746
Gene: ENSMUSG00000015087
AA Change: N620K

DomainStartEndE-ValueType
Pfam:Ras 45 108 1.5e-7 PFAM
Pfam:Roc 45 112 2.2e-8 PFAM
low complexity region 232 245 N/A INTRINSIC
low complexity region 291 325 N/A INTRINSIC
low complexity region 343 364 N/A INTRINSIC
low complexity region 378 397 N/A INTRINSIC
low complexity region 480 492 N/A INTRINSIC
coiled coil region 653 669 N/A INTRINSIC
low complexity region 708 720 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114217
SMART Domains Protein: ENSMUSP00000109855
Gene: ENSMUSG00000029419

DomainStartEndE-ValueType
low complexity region 61 92 N/A INTRINSIC
low complexity region 173 182 N/A INTRINSIC
low complexity region 271 284 N/A INTRINSIC
low complexity region 307 326 N/A INTRINSIC
low complexity region 617 636 N/A INTRINSIC
low complexity region 815 843 N/A INTRINSIC
low complexity region 880 894 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128942
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135084
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140635
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140778
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143855
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146012
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150206
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181730
Predicted Effect probably benign
Transcript: ENSMUST00000187017
Predicted Effect probably benign
Transcript: ENSMUST00000188161
SMART Domains Protein: ENSMUSP00000140763
Gene: ENSMUSG00000029419

DomainStartEndE-ValueType
low complexity region 61 92 N/A INTRINSIC
low complexity region 173 182 N/A INTRINSIC
low complexity region 271 284 N/A INTRINSIC
low complexity region 307 326 N/A INTRINSIC
low complexity region 617 636 N/A INTRINSIC
low complexity region 815 843 N/A INTRINSIC
low complexity region 880 894 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000191602
SMART Domains Protein: ENSMUSP00000140109
Gene: ENSMUSG00000029419

DomainStartEndE-ValueType
low complexity region 61 92 N/A INTRINSIC
low complexity region 173 182 N/A INTRINSIC
low complexity region 271 284 N/A INTRINSIC
low complexity region 307 326 N/A INTRINSIC
low complexity region 617 636 N/A INTRINSIC
low complexity region 815 843 N/A INTRINSIC
low complexity region 880 894 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.7%
Validation Efficiency 100% (47/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Ras superfamily of small GTPases. The encoded protein binds to both GTP and GDP and may play a role in cell growth and survival. Overexpression of this gene may play a role in breast cancer tumorigenesis, and pseudogenes of this gene are located on the long arm of chromosome 2 and the short arm of chromosome 18. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2011]
Allele List at MGI

All alleles(2) : Targeted, other(2)

Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AI661453 C A 17: 47,466,797 probably benign Het
Als2cr12 T A 1: 58,678,289 K154N probably damaging Het
Ank1 T A 8: 23,132,109 L1513Q probably damaging Het
Ap2a1 C A 7: 44,903,829 V676L probably benign Het
Arid2 T C 15: 96,363,694 V477A probably benign Het
Auh C A 13: 52,929,410 G17C probably benign Het
B3gnt7 T C 1: 86,306,117 F362L possibly damaging Het
Cd207 C T 6: 83,675,887 R87H probably benign Het
Cdyl A G 13: 35,871,606 K503R possibly damaging Het
Cep350 A G 1: 155,894,673 S1824P probably damaging Het
Cmas T A 6: 142,767,924 M225K probably benign Het
Dhx29 T C 13: 112,944,619 S396P possibly damaging Het
Epg5 T C 18: 77,975,885 S958P probably damaging Het
Espnl T C 1: 91,322,248 L39P possibly damaging Het
Fuk A G 8: 110,884,116 V915A probably benign Het
Gatb A G 3: 85,637,038 N438D probably benign Het
Hspg2 T C 4: 137,539,396 C1932R probably damaging Het
Jmjd1c C T 10: 67,224,160 T662I possibly damaging Het
Kcng4 A G 8: 119,633,050 S196P probably damaging Het
Kcnh7 T G 2: 62,850,532 H237P probably benign Het
Klhl38 T C 15: 58,322,311 T341A probably benign Het
Klra9 G T 6: 130,179,032 Y253* probably null Het
Man2c1 T C 9: 57,131,233 V59A possibly damaging Het
Nr2c1 A T 10: 94,195,341 H588L possibly damaging Het
Olfr137 T C 17: 38,305,358 I34M probably benign Het
Olfr305 A T 7: 86,363,973 Y121* probably null Het
Osbpl6 A G 2: 76,579,276 E494G probably damaging Het
Per1 T C 11: 69,104,296 L638S probably damaging Het
Plekhn1 T C 4: 156,221,804 E603G probably benign Het
Prss12 A T 3: 123,479,594 S280C probably damaging Het
Pudp A G 18: 50,568,236 I142T probably benign Het
Rttn T A 18: 89,021,685 C837S probably null Het
Slc16a7 A G 10: 125,231,018 S251P probably damaging Het
Slc7a10 A G 7: 35,197,658 I195V probably benign Het
Slc9a4 A T 1: 40,600,854 R269* probably null Het
Slco6c1 T A 1: 97,075,974 Q466L probably benign Het
Smc6 A G 12: 11,309,234 N953S probably benign Het
Tex15 T C 8: 33,571,301 V527A probably benign Het
Tln2 T C 9: 67,272,665 Y808C probably damaging Het
Tmem145 T C 7: 25,309,038 L289P possibly damaging Het
Trim3 A G 7: 105,618,005 V389A probably benign Het
Vmn1r3 G A 4: 3,184,971 T112I probably benign Het
Vps11 C A 9: 44,361,550 A28S probably benign Het
Zbtb41 T A 1: 139,447,207 S802T probably benign Het
Zmynd10 A T 9: 107,548,712 K82* probably null Het
Other mutations in Rabl6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00737:Rabl6 APN 2 25584120 unclassified probably benign
IGL00742:Rabl6 APN 2 25588687 missense probably damaging 0.96
IGL02231:Rabl6 APN 2 25598184 missense probably benign 0.41
IGL02424:Rabl6 APN 2 25587457 missense probably benign
IGL02514:Rabl6 APN 2 25608176 missense probably damaging 0.96
IGL03036:Rabl6 APN 2 25584856 missense probably benign 0.00
IGL03278:Rabl6 APN 2 25583822 unclassified probably benign
R0017:Rabl6 UTSW 2 25602567 splice site probably benign
R0269:Rabl6 UTSW 2 25586866 critical splice donor site probably null
R0442:Rabl6 UTSW 2 25587522 missense probably damaging 0.98
R0617:Rabl6 UTSW 2 25586866 critical splice donor site probably null
R0626:Rabl6 UTSW 2 25592766 critical splice donor site probably null
R1109:Rabl6 UTSW 2 25587526 missense probably damaging 1.00
R2034:Rabl6 UTSW 2 25585432 missense possibly damaging 0.59
R3914:Rabl6 UTSW 2 25588706 missense possibly damaging 0.91
R4255:Rabl6 UTSW 2 25584779 missense possibly damaging 0.91
R5177:Rabl6 UTSW 2 25585373 missense probably benign 0.18
R5389:Rabl6 UTSW 2 25588654 missense probably damaging 0.96
R6082:Rabl6 UTSW 2 25583825 unclassified probably benign
R6243:Rabl6 UTSW 2 25585403 missense probably damaging 0.98
R6501:Rabl6 UTSW 2 25602447 missense possibly damaging 0.92
R7485:Rabl6 UTSW 2 25584141 missense unknown
Predicted Primers PCR Primer
(F):5'- CACATTTGCCAGCTGGTGTG -3'
(R):5'- AGTCGTAAGTGAACTTGCCAAC -3'

Sequencing Primer
(F):5'- CCAGCTGGTGTGACAGTTTC -3'
(R):5'- GTAAGTGAACTTGCCAACCTTGTTTC -3'
Posted On2018-05-24