Incidental Mutation 'R6430:Gatb'
ID518472
Institutional Source Beutler Lab
Gene Symbol Gatb
Ensembl Gene ENSMUSG00000028085
Gene Nameglutamyl-tRNA(Gln) amidotransferase, subunit B
SynonymsPet112, Pet112l, 9430026F02Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.959) question?
Stock #R6430 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location85574119-85655622 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 85637038 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 438 (N438D)
Ref Sequence ENSEMBL: ENSMUSP00000103301 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107672] [ENSMUST00000107674] [ENSMUST00000127348] [ENSMUST00000154148]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000029726
Predicted Effect probably benign
Transcript: ENSMUST00000107672
AA Change: N438D

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000103299
Gene: ENSMUSG00000028085
AA Change: N438D

DomainStartEndE-ValueType
Pfam:GatB_N 65 353 8.3e-103 PFAM
Pfam:GatB_Yqey 406 472 6.3e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107674
AA Change: N438D

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000103301
Gene: ENSMUSG00000028085
AA Change: N438D

DomainStartEndE-ValueType
Pfam:GatB_N 64 354 6.7e-105 PFAM
GatB_Yqey 406 518 2.09e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000127348
AA Change: N438D

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000119949
Gene: ENSMUSG00000028085
AA Change: N438D

DomainStartEndE-ValueType
Pfam:GatB_N 65 353 8.3e-101 PFAM
GatB_Yqey 406 555 4.13e-53 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000154148
SMART Domains Protein: ENSMUSP00000116393
Gene: ENSMUSG00000102805

DomainStartEndE-ValueType
Arfaptin 1 227 7.15e-121 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.7%
Validation Efficiency 100% (47/47)
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AI661453 C A 17: 47,466,797 probably benign Het
Als2cr12 T A 1: 58,678,289 K154N probably damaging Het
Ank1 T A 8: 23,132,109 L1513Q probably damaging Het
Ap2a1 C A 7: 44,903,829 V676L probably benign Het
Arid2 T C 15: 96,363,694 V477A probably benign Het
Auh C A 13: 52,929,410 G17C probably benign Het
B3gnt7 T C 1: 86,306,117 F362L possibly damaging Het
Cd207 C T 6: 83,675,887 R87H probably benign Het
Cdyl A G 13: 35,871,606 K503R possibly damaging Het
Cep350 A G 1: 155,894,673 S1824P probably damaging Het
Cmas T A 6: 142,767,924 M225K probably benign Het
Dhx29 T C 13: 112,944,619 S396P possibly damaging Het
Epg5 T C 18: 77,975,885 S958P probably damaging Het
Espnl T C 1: 91,322,248 L39P possibly damaging Het
Fuk A G 8: 110,884,116 V915A probably benign Het
Hspg2 T C 4: 137,539,396 C1932R probably damaging Het
Jmjd1c C T 10: 67,224,160 T662I possibly damaging Het
Kcng4 A G 8: 119,633,050 S196P probably damaging Het
Kcnh7 T G 2: 62,850,532 H237P probably benign Het
Klhl38 T C 15: 58,322,311 T341A probably benign Het
Klra9 G T 6: 130,179,032 Y253* probably null Het
Man2c1 T C 9: 57,131,233 V59A possibly damaging Het
Nr2c1 A T 10: 94,195,341 H588L possibly damaging Het
Olfr137 T C 17: 38,305,358 I34M probably benign Het
Olfr305 A T 7: 86,363,973 Y121* probably null Het
Osbpl6 A G 2: 76,579,276 E494G probably damaging Het
Per1 T C 11: 69,104,296 L638S probably damaging Het
Plekhn1 T C 4: 156,221,804 E603G probably benign Het
Prss12 A T 3: 123,479,594 S280C probably damaging Het
Pudp A G 18: 50,568,236 I142T probably benign Het
Rabl6 A T 2: 25,584,837 N620K probably damaging Het
Rttn T A 18: 89,021,685 C837S probably null Het
Slc16a7 A G 10: 125,231,018 S251P probably damaging Het
Slc7a10 A G 7: 35,197,658 I195V probably benign Het
Slc9a4 A T 1: 40,600,854 R269* probably null Het
Slco6c1 T A 1: 97,075,974 Q466L probably benign Het
Smc6 A G 12: 11,309,234 N953S probably benign Het
Tex15 T C 8: 33,571,301 V527A probably benign Het
Tln2 T C 9: 67,272,665 Y808C probably damaging Het
Tmem145 T C 7: 25,309,038 L289P possibly damaging Het
Trim3 A G 7: 105,618,005 V389A probably benign Het
Vmn1r3 G A 4: 3,184,971 T112I probably benign Het
Vps11 C A 9: 44,361,550 A28S probably benign Het
Zbtb41 T A 1: 139,447,207 S802T probably benign Het
Zmynd10 A T 9: 107,548,712 K82* probably null Het
Other mutations in Gatb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Gatb APN 3 85601920 missense possibly damaging 0.95
IGL00963:Gatb APN 3 85618948 missense probably benign 0.00
IGL01363:Gatb APN 3 85652345 missense probably damaging 1.00
IGL01650:Gatb APN 3 85613484 missense possibly damaging 0.68
IGL01973:Gatb APN 3 85611424 missense probably damaging 1.00
IGL02195:Gatb APN 3 85604448 missense probably benign 0.00
IGL02670:Gatb APN 3 85613551 splice site probably null
IGL02992:Gatb APN 3 85618916 missense probably damaging 1.00
IGL03025:Gatb APN 3 85575874 missense probably damaging 0.99
IGL03035:Gatb APN 3 85601947 missense probably damaging 1.00
IGL03090:Gatb APN 3 85619023 intron probably benign
R1313:Gatb UTSW 3 85653826 missense probably benign 0.01
R1851:Gatb UTSW 3 85618877 missense probably damaging 0.99
R1852:Gatb UTSW 3 85618877 missense probably damaging 0.99
R2134:Gatb UTSW 3 85611370 missense probably damaging 1.00
R2209:Gatb UTSW 3 85653805 missense probably benign 0.03
R5189:Gatb UTSW 3 85636931 missense probably benign 0.00
R5218:Gatb UTSW 3 85604444 missense probably benign
R5857:Gatb UTSW 3 85575932 missense probably damaging 1.00
R5871:Gatb UTSW 3 85653776 nonsense probably null
R6031:Gatb UTSW 3 85613511 missense possibly damaging 0.82
R6031:Gatb UTSW 3 85613511 missense possibly damaging 0.82
R6661:Gatb UTSW 3 85652419 splice site probably null
R7184:Gatb UTSW 3 85636951 nonsense probably null
R7210:Gatb UTSW 3 85574220 missense probably benign
R7501:Gatb UTSW 3 85636990 missense probably damaging 0.99
X0013:Gatb UTSW 3 85601861 missense probably damaging 1.00
Z1177:Gatb UTSW 3 85636973 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACTGCCTTCCAAATTCGGGTC -3'
(R):5'- TTTCCAGATGGGTTGGACAC -3'

Sequencing Primer
(F):5'- CCAAATTCGGGTCTTTAAATTTAGGG -3'
(R):5'- CCAGATGGGTTGGACACTATTTTTAG -3'
Posted On2018-05-24