Incidental Mutation 'R6430:Olfr305'
ID518482
Institutional Source Beutler Lab
Gene Symbol Olfr305
Ensembl Gene ENSMUSG00000055571
Gene Nameolfactory receptor 305
SynonymsMOR219-2, GA_x6K02T2NHDJ-9744055-9745014
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.107) question?
Stock #R6430 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location86360854-86366928 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 86363973 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 121 (Y121*)
Ref Sequence ENSEMBL: ENSMUSP00000149883 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069236] [ENSMUST00000213255] [ENSMUST00000213869] [ENSMUST00000216700]
Predicted Effect probably null
Transcript: ENSMUST00000069236
AA Change: Y121*
SMART Domains Protein: ENSMUSP00000068650
Gene: ENSMUSG00000055571
AA Change: Y121*

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 2.3e-40 PFAM
Pfam:7tm_1 39 288 3.3e-21 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000213255
AA Change: Y121*
Predicted Effect probably null
Transcript: ENSMUST00000213869
AA Change: Y121*
Predicted Effect probably null
Transcript: ENSMUST00000216700
AA Change: Y121*
Meta Mutation Damage Score 0.9576 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.7%
Validation Efficiency 100% (47/47)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AI661453 C A 17: 47,466,797 probably benign Het
Als2cr12 T A 1: 58,678,289 K154N probably damaging Het
Ank1 T A 8: 23,132,109 L1513Q probably damaging Het
Ap2a1 C A 7: 44,903,829 V676L probably benign Het
Arid2 T C 15: 96,363,694 V477A probably benign Het
Auh C A 13: 52,929,410 G17C probably benign Het
B3gnt7 T C 1: 86,306,117 F362L possibly damaging Het
Cd207 C T 6: 83,675,887 R87H probably benign Het
Cdyl A G 13: 35,871,606 K503R possibly damaging Het
Cep350 A G 1: 155,894,673 S1824P probably damaging Het
Cmas T A 6: 142,767,924 M225K probably benign Het
Dhx29 T C 13: 112,944,619 S396P possibly damaging Het
Epg5 T C 18: 77,975,885 S958P probably damaging Het
Espnl T C 1: 91,322,248 L39P possibly damaging Het
Fuk A G 8: 110,884,116 V915A probably benign Het
Gatb A G 3: 85,637,038 N438D probably benign Het
Hspg2 T C 4: 137,539,396 C1932R probably damaging Het
Jmjd1c C T 10: 67,224,160 T662I possibly damaging Het
Kcng4 A G 8: 119,633,050 S196P probably damaging Het
Kcnh7 T G 2: 62,850,532 H237P probably benign Het
Klhl38 T C 15: 58,322,311 T341A probably benign Het
Klra9 G T 6: 130,179,032 Y253* probably null Het
Man2c1 T C 9: 57,131,233 V59A possibly damaging Het
Nr2c1 A T 10: 94,195,341 H588L possibly damaging Het
Olfr137 T C 17: 38,305,358 I34M probably benign Het
Osbpl6 A G 2: 76,579,276 E494G probably damaging Het
Per1 T C 11: 69,104,296 L638S probably damaging Het
Plekhn1 T C 4: 156,221,804 E603G probably benign Het
Prss12 A T 3: 123,479,594 S280C probably damaging Het
Pudp A G 18: 50,568,236 I142T probably benign Het
Rabl6 A T 2: 25,584,837 N620K probably damaging Het
Rttn T A 18: 89,021,685 C837S probably null Het
Slc16a7 A G 10: 125,231,018 S251P probably damaging Het
Slc7a10 A G 7: 35,197,658 I195V probably benign Het
Slc9a4 A T 1: 40,600,854 R269* probably null Het
Slco6c1 T A 1: 97,075,974 Q466L probably benign Het
Smc6 A G 12: 11,309,234 N953S probably benign Het
Tex15 T C 8: 33,571,301 V527A probably benign Het
Tln2 T C 9: 67,272,665 Y808C probably damaging Het
Tmem145 T C 7: 25,309,038 L289P possibly damaging Het
Trim3 A G 7: 105,618,005 V389A probably benign Het
Vmn1r3 G A 4: 3,184,971 T112I probably benign Het
Vps11 C A 9: 44,361,550 A28S probably benign Het
Zbtb41 T A 1: 139,447,207 S802T probably benign Het
Zmynd10 A T 9: 107,548,712 K82* probably null Het
Other mutations in Olfr305
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01071:Olfr305 APN 7 86363560 missense possibly damaging 0.46
IGL02102:Olfr305 APN 7 86363866 missense probably benign 0.25
IGL02424:Olfr305 APN 7 86363480 missense probably benign 0.02
IGL02664:Olfr305 APN 7 86363603 missense possibly damaging 0.94
IGL03167:Olfr305 APN 7 86363920 missense probably damaging 1.00
R0035:Olfr305 UTSW 7 86364187 missense possibly damaging 0.95
R0373:Olfr305 UTSW 7 86363805 nonsense probably null
R0510:Olfr305 UTSW 7 86363827 missense probably benign 0.21
R2214:Olfr305 UTSW 7 86364206 missense probably benign 0.01
R3147:Olfr305 UTSW 7 86363884 missense probably benign 0.01
R3623:Olfr305 UTSW 7 86364100 missense probably benign 0.02
R4155:Olfr305 UTSW 7 86364062 missense probably benign 0.00
R4332:Olfr305 UTSW 7 86363872 missense probably benign 0.01
R4785:Olfr305 UTSW 7 86363735 missense probably damaging 1.00
R4834:Olfr305 UTSW 7 86363744 missense probably benign 0.21
R4871:Olfr305 UTSW 7 86363484 missense probably damaging 1.00
R5161:Olfr305 UTSW 7 86364338 unclassified probably null
R5254:Olfr305 UTSW 7 86364190 missense possibly damaging 0.82
R7734:Olfr305 UTSW 7 86364268 missense not run
RF010:Olfr305 UTSW 7 86363386 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TCCAGAGCAGGAAATCCTTAAGAG -3'
(R):5'- CTGTGGATCTGAAGCTCCAAAC -3'

Sequencing Primer
(F):5'- GCAGGAAATCCTTAAGAGTGATG -3'
(R):5'- AACACCCATGTACTTCTTCTTGAAG -3'
Posted On2018-05-24