Incidental Mutation 'R6430:Cdyl'
ID518497
Institutional Source Beutler Lab
Gene Symbol Cdyl
Ensembl Gene ENSMUSG00000059288
Gene Namechromodomain protein, Y chromosome-like
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.600) question?
Stock #R6430 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location35659833-35874063 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 35871606 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 503 (K503R)
Ref Sequence ENSEMBL: ENSMUSP00000074707 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075220] [ENSMUST00000163595]
Predicted Effect possibly damaging
Transcript: ENSMUST00000075220
AA Change: K503R

PolyPhen 2 Score 0.740 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000074707
Gene: ENSMUSG00000059288
AA Change: K503R

DomainStartEndE-ValueType
CHROMO 55 109 2.06e-18 SMART
low complexity region 116 129 N/A INTRINSIC
Pfam:ECH_1 342 593 1.8e-35 PFAM
Pfam:ECH_2 348 592 6e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163595
AA Change: K454R

PolyPhen 2 Score 0.076 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000131784
Gene: ENSMUSG00000059288
AA Change: K454R

DomainStartEndE-ValueType
CHROMO 6 60 1.58e-19 SMART
low complexity region 67 80 N/A INTRINSIC
Pfam:ECH 291 539 4e-38 PFAM
Meta Mutation Damage Score 0.5367 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.7%
Validation Efficiency 100% (47/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Chromodomain Y is a primate-specific Y-chromosomal gene family expressed exclusively in the testis and implicated in infertility. Although the Y-linked genes are testis-specific, this autosomal gene is ubiquitously expressed. The Y-linked genes arose by retrotransposition of an mRNA from this gene, followed by amplification of the retroposed gene. Proteins encoded by this gene superfamily possess a chromodomain, a motif implicated in chromatin binding and gene suppression, and a catalytic domain believed to be involved in histone acetylation. Multiple proteins are encoded by transcript variants of this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Conditional homozygous knockout in the cerebral cortex affects neuronal migration and results in increased susceptibility to pharmacologically induced seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AI661453 C A 17: 47,466,797 probably benign Het
Als2cr12 T A 1: 58,678,289 K154N probably damaging Het
Ank1 T A 8: 23,132,109 L1513Q probably damaging Het
Ap2a1 C A 7: 44,903,829 V676L probably benign Het
Arid2 T C 15: 96,363,694 V477A probably benign Het
Auh C A 13: 52,929,410 G17C probably benign Het
B3gnt7 T C 1: 86,306,117 F362L possibly damaging Het
Cd207 C T 6: 83,675,887 R87H probably benign Het
Cep350 A G 1: 155,894,673 S1824P probably damaging Het
Cmas T A 6: 142,767,924 M225K probably benign Het
Dhx29 T C 13: 112,944,619 S396P possibly damaging Het
Epg5 T C 18: 77,975,885 S958P probably damaging Het
Espnl T C 1: 91,322,248 L39P possibly damaging Het
Fuk A G 8: 110,884,116 V915A probably benign Het
Gatb A G 3: 85,637,038 N438D probably benign Het
Hspg2 T C 4: 137,539,396 C1932R probably damaging Het
Jmjd1c C T 10: 67,224,160 T662I possibly damaging Het
Kcng4 A G 8: 119,633,050 S196P probably damaging Het
Kcnh7 T G 2: 62,850,532 H237P probably benign Het
Klhl38 T C 15: 58,322,311 T341A probably benign Het
Klra9 G T 6: 130,179,032 Y253* probably null Het
Man2c1 T C 9: 57,131,233 V59A possibly damaging Het
Nr2c1 A T 10: 94,195,341 H588L possibly damaging Het
Olfr137 T C 17: 38,305,358 I34M probably benign Het
Olfr305 A T 7: 86,363,973 Y121* probably null Het
Osbpl6 A G 2: 76,579,276 E494G probably damaging Het
Per1 T C 11: 69,104,296 L638S probably damaging Het
Plekhn1 T C 4: 156,221,804 E603G probably benign Het
Prss12 A T 3: 123,479,594 S280C probably damaging Het
Pudp A G 18: 50,568,236 I142T probably benign Het
Rabl6 A T 2: 25,584,837 N620K probably damaging Het
Rttn T A 18: 89,021,685 C837S probably null Het
Slc16a7 A G 10: 125,231,018 S251P probably damaging Het
Slc7a10 A G 7: 35,197,658 I195V probably benign Het
Slc9a4 A T 1: 40,600,854 R269* probably null Het
Slco6c1 T A 1: 97,075,974 Q466L probably benign Het
Smc6 A G 12: 11,309,234 N953S probably benign Het
Tex15 T C 8: 33,571,301 V527A probably benign Het
Tln2 T C 9: 67,272,665 Y808C probably damaging Het
Tmem145 T C 7: 25,309,038 L289P possibly damaging Het
Trim3 A G 7: 105,618,005 V389A probably benign Het
Vmn1r3 G A 4: 3,184,971 T112I probably benign Het
Vps11 C A 9: 44,361,550 A28S probably benign Het
Zbtb41 T A 1: 139,447,207 S802T probably benign Het
Zmynd10 A T 9: 107,548,712 K82* probably null Het
Other mutations in Cdyl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00981:Cdyl APN 13 35816113 missense probably damaging 0.98
IGL01547:Cdyl APN 13 35790162 missense possibly damaging 0.90
IGL01911:Cdyl APN 13 35863243 missense probably damaging 0.97
IGL02584:Cdyl APN 13 35683786 missense probably benign
IGL02754:Cdyl APN 13 35683742 splice site probably benign
R1630:Cdyl UTSW 13 35683803 missense possibly damaging 0.66
R1678:Cdyl UTSW 13 35856889 missense probably damaging 0.99
R1802:Cdyl UTSW 13 35872636 nonsense probably null
R4435:Cdyl UTSW 13 35858250 critical splice donor site probably null
R5841:Cdyl UTSW 13 35872561 missense probably damaging 1.00
R5860:Cdyl UTSW 13 35858083 missense possibly damaging 0.73
R7127:Cdyl UTSW 13 35856668 missense probably benign 0.01
R7296:Cdyl UTSW 13 35863395 missense probably damaging 1.00
R7369:Cdyl UTSW 13 35816009 missense probably damaging 1.00
R7422:Cdyl UTSW 13 35858194 missense possibly damaging 0.90
R7635:Cdyl UTSW 13 35871651 missense probably damaging 1.00
R7756:Cdyl UTSW 13 35872641 missense probably damaging 1.00
R7758:Cdyl UTSW 13 35872641 missense probably damaging 1.00
R7764:Cdyl UTSW 13 35816143 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- GTCTGTGACCACTAGAGGATATG -3'
(R):5'- GGGAACACATTGGAACACGC -3'

Sequencing Primer
(F):5'- CACTAGAGGATATGAGGTAGACCCCC -3'
(R):5'- CCAGTCTAACTTAATCTCTGTGGAGG -3'
Posted On2018-05-24