Mutagenetix > Incidental Mutation

Incidental Mutation 'R6431:Lamc1'

518513

Institutional Source

Beutler Lab

Gene Symbol

Lamc1

Ensembl Gene

ENSMUSG00000026478

Gene Name

laminin, gamma 1

Synonyms

laminin B2, Lamb2

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R6431 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

153218922-153332786 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 153221671 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Asparagine at position 1542 (K1542N)

Ref Sequence

ENSEMBL: ENSMUSP00000027752 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027752]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000027752
AA Change: K1542N

PolyPhen 2 Score 0.207 (Sensitivity: 0.92; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000027752
Gene: ENSMUSG00000026478
AA Change: K1542N

Domain	Start	End	E-Value	Type
signal peptide	1	33	N/A	INTRINSIC
LamNT	42	282	1.97e-150	SMART
EGF_Lam	284	337	7.18e-7	SMART
EGF_Lam	340	393	7.93e-9	SMART
EGF_Lam	396	440	2.11e-13	SMART
EGF_Lam	443	490	2.87e-15	SMART
LamB	551	676	5.52e-48	SMART
Pfam:Laminin_EGF	683	718	1.3e-4	PFAM
EGF_Lam	722	768	2.38e-12	SMART
EGF_Lam	771	823	1.39e-4	SMART
EGF_Lam	826	879	8.05e-10	SMART
EGF_Lam	882	930	8.9e-12	SMART
EGF_Lam	933	978	1.26e-11	SMART
EGF_Lam	981	1026	7.4e-9	SMART
coiled coil region	1063	1594	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000161744

SMART Domains

Protein: ENSMUSP00000124662
Gene: ENSMUSG00000026478

Domain	Start	End	E-Value	Type
coiled coil region	1	73	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.7%
10x: 98.2%
20x: 93.9%

Validation Efficiency

100% (68/68)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Laminins, a family of extracellular matrix glycoproteins, are the major noncollagenous constituent of basement membranes. They have been implicated in a wide variety of biological processes including cell adhesion, differentiation, migration, signaling, neurite outgrowth and metastasis. Laminins, composed of 3 non identical chains: laminin alpha, beta and gamma (formerly A, B1, and B2, respectively), have a cruciform structure consisting of 3 short arms, each formed by a different chain, and a long arm composed of all 3 chains. Each laminin chain is a multidomain protein encoded by a distinct gene. Several isoforms of each chain have been described. Different alpha, beta and gamma chain isomers combine to give rise to different heterotrimeric laminin isoforms which are designated by Arabic numerals in the order of their discovery, i.e. alpha1beta1gamma1 heterotrimer is laminin 1. The biological functions of the different chains and trimer molecules are largely unknown, but some of the chains have been shown to differ with respect to their tissue distribution, presumably reflecting diverse functions in vivo. This gene encodes the gamma chain isoform laminin, gamma 1. The gamma 1 chain, formerly thought to be a beta chain, contains structural domains similar to beta chains, however, lacks the short alpha region separating domains I and II. The structural organization of this gene also suggested that it had diverged considerably from the beta chain genes. Embryos of transgenic mice in which both alleles of the gamma 1 chain gene were inactivated by homologous recombination, lacked basement membranes, indicating that laminin, gamma 1 chain is necessary for laminin heterotrimer assembly. It has been inferred by analogy with the strikingly similar 3' UTR sequence in mouse laminin gamma 1 cDNA, that multiple polyadenylation sites are utilized in human to generate the 2 different sized mRNAs (5.5 and 7.5 kb) seen on Northern analysis. [provided by RefSeq, Aug 2011]
PHENOTYPE: Embryos homozygous for a targeted null mutation lack development of basement membranes, migration of primitive endoderm cells out of the inner cell mass, and parietal yolk sac development, resulting in lethality by embryonic day 5.5. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 69 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931408C20Rik	T	A	1: 26,684,030	N690Y	probably benign	Het
Adcy5	A	G	16: 35,279,237	E719G	probably damaging	Het
Ankdd1a	A	G	9: 65,516,938	M31T	possibly damaging	Het
Atp13a5	T	C	16: 29,251,402	K911E	possibly damaging	Het
Bpifb3	G	T	2: 153,924,808	L210F	probably damaging	Het
Cacna1c	T	C	6: 118,751,373	Y211C	probably damaging	Het
Carm1	C	A	9: 21,583,077	P297T	probably damaging	Het
Cdh19	A	T	1: 110,925,057	Y383N	probably benign	Het
Cfap221	T	C	1: 119,932,853	H681R	probably damaging	Het
Cmya5	A	C	13: 93,074,464	S3274A	possibly damaging	Het
Cndp2	T	A	18: 84,675,078	K186*	probably null	Het
Ctdp1	G	T	18: 80,451,255	F310L	probably damaging	Het
Cyp2c55	A	T	19: 39,031,409	I264F	probably damaging	Het
Dhx40	A	T	11: 86,773,823	F628I	probably damaging	Het
Disc1	T	A	8: 125,135,389	M500K	possibly damaging	Het
Dnah5	A	C	15: 28,349,824	D2551A	possibly damaging	Het
Esyt1	A	G	10: 128,516,674		probably null	Het
Fam78a	T	C	2: 32,082,831	S26G	probably damaging	Het
Fn1	G	A	1: 71,647,844		probably null	Het
Gbx1	T	C	5: 24,504,918	T310A	probably benign	Het
Ggh	T	A	4: 20,042,219	C16S	unknown	Het
Gm11595	T	A	11: 99,772,774	T27S	unknown	Het
Gm17334	T	A	11: 53,772,738		probably benign	Het
Gsk3b	A	G	16: 38,193,949	I256M	probably damaging	Het
Hmcn1	A	T	1: 150,744,960	S1166R	probably benign	Het
Hyou1	T	C	9: 44,382,025		probably null	Het
Jup	G	T	11: 100,374,341	R637S	probably benign	Het
Lama2	T	A	10: 27,053,031	I2087F	possibly damaging	Het
Lgals4	G	T	7: 28,840,692			Het
Lrrc8d	A	G	5: 105,811,760	D12G	probably damaging	Het
Lrwd1	C	T	5: 136,133,034	V207M	possibly damaging	Het
Mbd1	T	A	18: 74,273,691		probably null	Het
Msi1	T	A	5: 115,450,925	I333N	probably damaging	Het
Neo1	C	T	9: 58,907,071	V871I	probably benign	Het
Nr2c1	T	C	10: 94,188,216	C428R	probably damaging	Het
Ntm	A	G	9: 29,411,682	L14P	probably damaging	Het
Nxpe4	A	T	9: 48,392,845	K77N	probably damaging	Het
Olfr1049	G	A	2: 86,255,358	L112F	probably benign	Het
Olfr1224-ps1	T	A	2: 89,157,161	S5C	probably damaging	Het
Olfr1293-ps	T	A	2: 111,527,656	M132K	probably damaging	Het
Olfr406	A	C	11: 74,269,409	T7P	possibly damaging	Het
Olfr948	T	C	9: 39,318,778	T279A	possibly damaging	Het
Pappa	T	A	4: 65,156,464	D418E	probably damaging	Het
Pde4d	G	A	13: 109,601,786		probably null	Het
Pip	A	G	6: 41,851,457	N75S	possibly damaging	Het
Plcl1	G	C	1: 55,697,252	R584P	probably benign	Het
Pnp	A	T	14: 50,951,014	D237V	probably damaging	Het
Ppp1r12a	T	C	10: 108,262,420	W857R	probably damaging	Het
Pramef12	T	C	4: 144,393,083	T305A	possibly damaging	Het
Ptchd3	A	T	11: 121,836,403	M368L	probably benign	Het
Pum1	T	A	4: 130,774,505	S868R	probably damaging	Het
R3hdml	A	T	2: 163,502,404	S238C	probably damaging	Het
Robo2	G	A	16: 74,046,809	R173*	probably null	Het
Sall3	A	G	18: 80,973,187	S509P	possibly damaging	Het
Sap130	T	G	18: 31,666,365	H298Q	possibly damaging	Het
Selenov	C	A	7: 28,288,033	G307C	probably damaging	Het
Setd2	T	A	9: 110,550,385	H1089Q	possibly damaging	Het
Setdb2	T	C	14: 59,419,056	N287D	probably damaging	Het
Sis	C	T	3: 72,958,174	V182I	probably benign	Het
Slc32a1	A	C	2: 158,611,537	D99A	probably benign	Het
Slk	A	G	19: 47,620,888	D760G	probably damaging	Het
Smg5	T	A	3: 88,351,220	D499E	probably benign	Het
Stat3	T	C	11: 100,889,574	T720A	possibly damaging	Het
Trdn	T	G	10: 33,139,114	N21K	probably damaging	Het
Trpm4	A	T	7: 45,326,568	V118E	possibly damaging	Het
Vgll3	A	G	16: 65,815,754	Q41R	probably damaging	Het
Vmn1r189	A	G	13: 22,102,355	V104A	probably damaging	Het
Vmn1r46	A	T	6: 89,976,407	R79S	probably benign	Het
Zscan4c	T	C	7: 11,006,929	M125T	probably benign	Het

Other mutations in Lamc1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00950:Lamc1	APN	1	153240495	missense	probably damaging	1.00
IGL01397:Lamc1	APN	1	153251134	missense	probably damaging	1.00
IGL01661:Lamc1	APN	1	153221573	missense	possibly damaging	0.89
IGL01894:Lamc1	APN	1	153247082	missense	possibly damaging	0.51
IGL02000:Lamc1	APN	1	153240433	missense	probably damaging	1.00
IGL02649:Lamc1	APN	1	153247042	missense	possibly damaging	0.78
IGL02749:Lamc1	APN	1	153249853	missense	possibly damaging	0.51
IGL02819:Lamc1	APN	1	153250661	missense	probably damaging	1.00
IGL02831:Lamc1	APN	1	153247055	missense	probably benign	0.00
IGL03069:Lamc1	APN	1	153239381	missense	probably damaging	1.00
IGL03143:Lamc1	APN	1	153332274	missense	probably benign	0.00
IGL03166:Lamc1	APN	1	153332301	missense	probably benign	0.01
IGL03285:Lamc1	APN	1	153227685	missense	possibly damaging	0.96
IGL03294:Lamc1	APN	1	153262646	missense	probably damaging	1.00
pride	UTSW	1	153247284	missense	probably benign	0.01
Stratum	UTSW	1	153251124	nonsense	probably null
tier	UTSW	1	153250522	missense	probably damaging	1.00
PIT4280001:Lamc1	UTSW	1	153243471	missense	probably damaging	1.00
R0003:Lamc1	UTSW	1	153262439	missense	probably damaging	0.99
R0003:Lamc1	UTSW	1	153262439	missense	probably damaging	0.99
R0027:Lamc1	UTSW	1	153262583	missense	probably damaging	1.00
R0060:Lamc1	UTSW	1	153241868	unclassified	probably benign
R0078:Lamc1	UTSW	1	153229190	missense	probably damaging	0.96
R0157:Lamc1	UTSW	1	153262607	missense	probably benign	0.00
R0282:Lamc1	UTSW	1	153255312	missense	probably benign
R0374:Lamc1	UTSW	1	153251065	splice site	probably benign
R0494:Lamc1	UTSW	1	153246936	critical splice donor site	probably null
R0502:Lamc1	UTSW	1	153246932	splice site	probably benign
R0755:Lamc1	UTSW	1	153247450	missense	possibly damaging	0.94
R0791:Lamc1	UTSW	1	153234580	missense	possibly damaging	0.94
R0791:Lamc1	UTSW	1	153234595	missense	probably damaging	1.00
R0791:Lamc1	UTSW	1	153234612	missense	probably benign	0.01
R0792:Lamc1	UTSW	1	153234580	missense	possibly damaging	0.94
R0792:Lamc1	UTSW	1	153234595	missense	probably damaging	1.00
R0792:Lamc1	UTSW	1	153234612	missense	probably benign	0.01
R0892:Lamc1	UTSW	1	153332254	missense	possibly damaging	0.95
R0941:Lamc1	UTSW	1	153332274	missense	possibly damaging	0.72
R0961:Lamc1	UTSW	1	153221646	frame shift	probably null
R0961:Lamc1	UTSW	1	153221700	missense	probably benign	0.03
R0963:Lamc1	UTSW	1	153243386	missense	probably benign
R1127:Lamc1	UTSW	1	153250459	missense	possibly damaging	0.69
R1173:Lamc1	UTSW	1	153247231	splice site	probably benign
R1175:Lamc1	UTSW	1	153247231	splice site	probably benign
R1449:Lamc1	UTSW	1	153250495	missense	probably benign
R1481:Lamc1	UTSW	1	153221634	missense	probably damaging	1.00
R1565:Lamc1	UTSW	1	153242743	missense	probably benign	0.34
R1583:Lamc1	UTSW	1	153243478	critical splice acceptor site	probably null
R1643:Lamc1	UTSW	1	153258072	splice site	probably benign
R1652:Lamc1	UTSW	1	153249646	missense	probably damaging	1.00
R1691:Lamc1	UTSW	1	153247249	missense	probably benign	0.04
R1854:Lamc1	UTSW	1	153249872	missense	probably damaging	0.99
R2018:Lamc1	UTSW	1	153242632	missense	probably benign	0.07
R2170:Lamc1	UTSW	1	153249142	missense	probably benign	0.07
R2410:Lamc1	UTSW	1	153247395	missense	possibly damaging	0.61
R3438:Lamc1	UTSW	1	153226415	missense	probably benign	0.04
R3615:Lamc1	UTSW	1	153251150	missense	probably damaging	1.00
R3616:Lamc1	UTSW	1	153251150	missense	probably damaging	1.00
R3699:Lamc1	UTSW	1	153255205	missense	possibly damaging	0.79
R3811:Lamc1	UTSW	1	153262708	splice site	probably null
R4285:Lamc1	UTSW	1	153234552	missense	probably damaging	0.99
R4431:Lamc1	UTSW	1	153221528	missense	probably damaging	1.00
R4579:Lamc1	UTSW	1	153247269	missense	probably damaging	1.00
R4625:Lamc1	UTSW	1	153242696	missense	probably benign	0.04
R4649:Lamc1	UTSW	1	153228777	missense	probably damaging	0.99
R4650:Lamc1	UTSW	1	153228777	missense	probably damaging	0.99
R4651:Lamc1	UTSW	1	153228777	missense	probably damaging	0.99
R4652:Lamc1	UTSW	1	153228777	missense	probably damaging	0.99
R4653:Lamc1	UTSW	1	153228777	missense	probably damaging	0.99
R4784:Lamc1	UTSW	1	153231740	missense	probably damaging	1.00
R4785:Lamc1	UTSW	1	153231740	missense	probably damaging	1.00
R4853:Lamc1	UTSW	1	153229100	missense	possibly damaging	0.89
R5216:Lamc1	UTSW	1	153227696	missense	probably damaging	1.00
R5217:Lamc1	UTSW	1	153227696	missense	probably damaging	1.00
R5218:Lamc1	UTSW	1	153227696	missense	probably damaging	1.00
R5219:Lamc1	UTSW	1	153227696	missense	probably damaging	1.00
R5468:Lamc1	UTSW	1	153233564	missense	probably damaging	0.99
R5597:Lamc1	UTSW	1	153251970	missense	probably damaging	1.00
R5754:Lamc1	UTSW	1	153247284	missense	probably benign	0.01
R6233:Lamc1	UTSW	1	153223666	missense	probably benign
R6636:Lamc1	UTSW	1	153241975	missense	possibly damaging	0.93
R6888:Lamc1	UTSW	1	153262492	missense	probably damaging	1.00
R7161:Lamc1	UTSW	1	153226454	missense	probably damaging	1.00
R7240:Lamc1	UTSW	1	153234650	missense	possibly damaging	0.82
R7388:Lamc1	UTSW	1	153249076	missense	probably damaging	1.00
R7474:Lamc1	UTSW	1	153332265	missense	possibly damaging	0.81
R7570:Lamc1	UTSW	1	153243275	missense	possibly damaging	0.64
R7583:Lamc1	UTSW	1	153243232	missense	possibly damaging	0.71
R7597:Lamc1	UTSW	1	153240454	missense	possibly damaging	0.94
R7635:Lamc1	UTSW	1	153249060	missense	probably damaging	1.00
R7976:Lamc1	UTSW	1	153247268	missense	probably damaging	1.00
R8012:Lamc1	UTSW	1	153221612	missense	probably benign	0.04
R8207:Lamc1	UTSW	1	153250522	missense	probably damaging	1.00
R8219:Lamc1	UTSW	1	153247327	missense	probably damaging	1.00
R8227:Lamc1	UTSW	1	153223754	missense	probably benign	0.04
R8315:Lamc1	UTSW	1	153243421	missense	probably benign	0.00
R8417:Lamc1	UTSW	1	153230769	missense	probably damaging	1.00
R8685:Lamc1	UTSW	1	153233542	missense	probably benign	0.31
R8827:Lamc1	UTSW	1	153221678	missense	probably damaging	1.00
R8995:Lamc1	UTSW	1	153332247	missense	probably benign	0.00
R9061:Lamc1	UTSW	1	153251124	nonsense	probably null
R9141:Lamc1	UTSW	1	153247450	missense	probably benign	0.01
R9187:Lamc1	UTSW	1	153221688	nonsense	probably null
R9206:Lamc1	UTSW	1	153250451	missense	probably damaging	1.00
R9222:Lamc1	UTSW	1	153243341	missense	probably damaging	0.96
R9297:Lamc1	UTSW	1	153252000	missense	probably damaging	1.00
R9318:Lamc1	UTSW	1	153252000	missense	probably damaging	1.00
R9377:Lamc1	UTSW	1	153239263	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- TTGAAGCAGCCGGTTGGTAG -3'
(R):5'- AGTCACCTTCTTCAGCATAAGC -3'

Sequencing Primer
(F):5'- AGGGTCTTCTTGATGTCCTCCAG -3'
(R):5'- TCCCTGGAAACCTCATAGTGG -3'

Posted On

2018-05-24