Incidental Mutation 'R6431:Pramef12'
ID518526
Institutional Source Beutler Lab
Gene Symbol Pramef12
Ensembl Gene ENSMUSG00000028591
Gene NamePRAME family member 12
Synonyms4930569K13Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R6431 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location144391674-144408464 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 144393083 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 305 (T305A)
Ref Sequence ENSEMBL: ENSMUSP00000030326 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030326] [ENSMUST00000123854]
Predicted Effect possibly damaging
Transcript: ENSMUST00000030326
AA Change: T305A

PolyPhen 2 Score 0.826 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000030326
Gene: ENSMUSG00000028591
AA Change: T305A

DomainStartEndE-ValueType
SCOP:d1a4ya_ 223 414 7e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000123854
Meta Mutation Damage Score 0.2999 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.7%
  • 10x: 98.2%
  • 20x: 93.9%
Validation Efficiency 100% (68/68)
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik T A 1: 26,684,030 N690Y probably benign Het
Adcy5 A G 16: 35,279,237 E719G probably damaging Het
Ankdd1a A G 9: 65,516,938 M31T possibly damaging Het
Atp13a5 T C 16: 29,251,402 K911E possibly damaging Het
Bpifb3 G T 2: 153,924,808 L210F probably damaging Het
Cacna1c T C 6: 118,751,373 Y211C probably damaging Het
Carm1 C A 9: 21,583,077 P297T probably damaging Het
Cdh19 A T 1: 110,925,057 Y383N probably benign Het
Cfap221 T C 1: 119,932,853 H681R probably damaging Het
Cmya5 A C 13: 93,074,464 S3274A possibly damaging Het
Cndp2 T A 18: 84,675,078 K186* probably null Het
Ctdp1 G T 18: 80,451,255 F310L probably damaging Het
Cyp2c55 A T 19: 39,031,409 I264F probably damaging Het
Dhx40 A T 11: 86,773,823 F628I probably damaging Het
Disc1 T A 8: 125,135,389 M500K possibly damaging Het
Dnah5 A C 15: 28,349,824 D2551A possibly damaging Het
Esyt1 A G 10: 128,516,674 probably null Het
Fam78a T C 2: 32,082,831 S26G probably damaging Het
Fn1 G A 1: 71,647,844 probably null Het
Gbx1 T C 5: 24,504,918 T310A probably benign Het
Ggh T A 4: 20,042,219 C16S unknown Het
Gm11595 T A 11: 99,772,774 T27S unknown Het
Gm17334 T A 11: 53,772,738 probably benign Het
Gsk3b A G 16: 38,193,949 I256M probably damaging Het
Hmcn1 A T 1: 150,744,960 S1166R probably benign Het
Hyou1 T C 9: 44,382,025 probably null Het
Jup G T 11: 100,374,341 R637S probably benign Het
Lama2 T A 10: 27,053,031 I2087F possibly damaging Het
Lamc1 T G 1: 153,221,671 K1542N probably benign Het
Lgals4 G T 7: 28,840,692 Het
Lrrc8d A G 5: 105,811,760 D12G probably damaging Het
Lrwd1 C T 5: 136,133,034 V207M possibly damaging Het
Mbd1 T A 18: 74,273,691 probably null Het
Msi1 T A 5: 115,450,925 I333N probably damaging Het
Neo1 C T 9: 58,907,071 V871I probably benign Het
Nr2c1 T C 10: 94,188,216 C428R probably damaging Het
Ntm A G 9: 29,411,682 L14P probably damaging Het
Nxpe4 A T 9: 48,392,845 K77N probably damaging Het
Olfr1049 G A 2: 86,255,358 L112F probably benign Het
Olfr1224-ps1 T A 2: 89,157,161 S5C probably damaging Het
Olfr1293-ps T A 2: 111,527,656 M132K probably damaging Het
Olfr406 A C 11: 74,269,409 T7P possibly damaging Het
Olfr948 T C 9: 39,318,778 T279A possibly damaging Het
Pappa T A 4: 65,156,464 D418E probably damaging Het
Pde4d G A 13: 109,601,786 probably null Het
Pip A G 6: 41,851,457 N75S possibly damaging Het
Plcl1 G C 1: 55,697,252 R584P probably benign Het
Pnp A T 14: 50,951,014 D237V probably damaging Het
Ppp1r12a T C 10: 108,262,420 W857R probably damaging Het
Ptchd3 A T 11: 121,836,403 M368L probably benign Het
Pum1 T A 4: 130,774,505 S868R probably damaging Het
R3hdml A T 2: 163,502,404 S238C probably damaging Het
Robo2 G A 16: 74,046,809 R173* probably null Het
Sall3 A G 18: 80,973,187 S509P possibly damaging Het
Sap130 T G 18: 31,666,365 H298Q possibly damaging Het
Selenov C A 7: 28,288,033 G307C probably damaging Het
Setd2 T A 9: 110,550,385 H1089Q possibly damaging Het
Setdb2 T C 14: 59,419,056 N287D probably damaging Het
Sis C T 3: 72,958,174 V182I probably benign Het
Slc32a1 A C 2: 158,611,537 D99A probably benign Het
Slk A G 19: 47,620,888 D760G probably damaging Het
Smg5 T A 3: 88,351,220 D499E probably benign Het
Stat3 T C 11: 100,889,574 T720A possibly damaging Het
Trdn T G 10: 33,139,114 N21K probably damaging Het
Trpm4 A T 7: 45,326,568 V118E possibly damaging Het
Vgll3 A G 16: 65,815,754 Q41R probably damaging Het
Vmn1r189 A G 13: 22,102,355 V104A probably damaging Het
Vmn1r46 A T 6: 89,976,407 R79S probably benign Het
Zscan4c T C 7: 11,006,929 M125T probably benign Het
Other mutations in Pramef12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00324:Pramef12 APN 4 144394740 missense possibly damaging 0.91
IGL01107:Pramef12 APN 4 144393094 missense probably benign 0.00
IGL01935:Pramef12 APN 4 144392602 unclassified probably benign
IGL02436:Pramef12 APN 4 144392969 missense possibly damaging 0.95
IGL02491:Pramef12 APN 4 144394752 missense probably damaging 1.00
IGL02744:Pramef12 APN 4 144392923 missense probably damaging 1.00
IGL03338:Pramef12 APN 4 144394827 missense probably benign 0.01
R0005:Pramef12 UTSW 4 144395853 missense probably damaging 1.00
R1401:Pramef12 UTSW 4 144395088 missense probably benign 0.00
R1611:Pramef12 UTSW 4 144392812 missense probably benign 0.20
R1667:Pramef12 UTSW 4 144393036 nonsense probably null
R2017:Pramef12 UTSW 4 144394674 missense possibly damaging 0.49
R2290:Pramef12 UTSW 4 144394699 missense probably benign 0.00
R2290:Pramef12 UTSW 4 144395122 missense probably benign 0.19
R2310:Pramef12 UTSW 4 144392905 unclassified probably null
R2912:Pramef12 UTSW 4 144392734 missense probably damaging 1.00
R2913:Pramef12 UTSW 4 144392734 missense probably damaging 1.00
R4558:Pramef12 UTSW 4 144395972 start codon destroyed probably null 1.00
R5162:Pramef12 UTSW 4 144394912 missense probably damaging 0.96
R5521:Pramef12 UTSW 4 144395971 start codon destroyed probably null 1.00
R5530:Pramef12 UTSW 4 144392662 missense probably benign 0.03
R5669:Pramef12 UTSW 4 144395843 missense probably benign 0.03
R6032:Pramef12 UTSW 4 144393028 missense possibly damaging 0.82
R6032:Pramef12 UTSW 4 144393028 missense possibly damaging 0.82
R6314:Pramef12 UTSW 4 144394587 missense probably damaging 0.98
R6322:Pramef12 UTSW 4 144392905 missense probably benign 0.09
R7729:Pramef12 UTSW 4 144392864 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAAGCTGAGCACATTGGCTCAG -3'
(R):5'- CTCTTAAGAGGCAGCATACTAGG -3'

Sequencing Primer
(F):5'- TCAAGCTGGGAGTCCATAATC -3'
(R):5'- GCAGCATACTAGGTATTGATGC -3'
Posted On2018-05-24