Incidental Mutation 'R6431:Olfr406'
ID518552
Institutional Source Beutler Lab
Gene Symbol Olfr406
Ensembl Gene ENSMUSG00000070375
Gene Nameolfactory receptor 406
SynonymsOlfr406-ps, GA_x6K02T2P1NL-4415162-4416133, MOR133-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock #R6431 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location74259808-74271625 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 74269409 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Proline at position 7 (T7P)
Ref Sequence ENSEMBL: ENSMUSP00000148929 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000133561] [ENSMUST00000214303] [ENSMUST00000217016]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127098
Predicted Effect possibly damaging
Transcript: ENSMUST00000133561
AA Change: T7P

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000125963
Gene: ENSMUSG00000070375
AA Change: T7P

DomainStartEndE-ValueType
Pfam:7tm_4 31 310 3.5e-56 PFAM
Pfam:7tm_1 41 292 3e-27 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000214303
AA Change: T7P

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)
Predicted Effect possibly damaging
Transcript: ENSMUST00000217016
AA Change: T7P

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.7%
  • 10x: 98.2%
  • 20x: 93.9%
Validation Efficiency 100% (68/68)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik T A 1: 26,684,030 N690Y probably benign Het
Adcy5 A G 16: 35,279,237 E719G probably damaging Het
Ankdd1a A G 9: 65,516,938 M31T possibly damaging Het
Atp13a5 T C 16: 29,251,402 K911E possibly damaging Het
Bpifb3 G T 2: 153,924,808 L210F probably damaging Het
Cacna1c T C 6: 118,751,373 Y211C probably damaging Het
Carm1 C A 9: 21,583,077 P297T probably damaging Het
Cdh19 A T 1: 110,925,057 Y383N probably benign Het
Cfap221 T C 1: 119,932,853 H681R probably damaging Het
Cmya5 A C 13: 93,074,464 S3274A possibly damaging Het
Cndp2 T A 18: 84,675,078 K186* probably null Het
Ctdp1 G T 18: 80,451,255 F310L probably damaging Het
Cyp2c55 A T 19: 39,031,409 I264F probably damaging Het
Dhx40 A T 11: 86,773,823 F628I probably damaging Het
Disc1 T A 8: 125,135,389 M500K possibly damaging Het
Dnah5 A C 15: 28,349,824 D2551A possibly damaging Het
Esyt1 A G 10: 128,516,674 probably null Het
Fam78a T C 2: 32,082,831 S26G probably damaging Het
Fn1 G A 1: 71,647,844 probably null Het
Gbx1 T C 5: 24,504,918 T310A probably benign Het
Ggh T A 4: 20,042,219 C16S unknown Het
Gm11595 T A 11: 99,772,774 T27S unknown Het
Gm17334 T A 11: 53,772,738 probably benign Het
Gsk3b A G 16: 38,193,949 I256M probably damaging Het
Hmcn1 A T 1: 150,744,960 S1166R probably benign Het
Hyou1 T C 9: 44,382,025 probably null Het
Jup G T 11: 100,374,341 R637S probably benign Het
Lama2 T A 10: 27,053,031 I2087F possibly damaging Het
Lamc1 T G 1: 153,221,671 K1542N probably benign Het
Lgals4 G T 7: 28,840,692 Het
Lrrc8d A G 5: 105,811,760 D12G probably damaging Het
Lrwd1 C T 5: 136,133,034 V207M possibly damaging Het
Mbd1 T A 18: 74,273,691 probably null Het
Msi1 T A 5: 115,450,925 I333N probably damaging Het
Neo1 C T 9: 58,907,071 V871I probably benign Het
Nr2c1 T C 10: 94,188,216 C428R probably damaging Het
Ntm A G 9: 29,411,682 L14P probably damaging Het
Nxpe4 A T 9: 48,392,845 K77N probably damaging Het
Olfr1049 G A 2: 86,255,358 L112F probably benign Het
Olfr1224-ps1 T A 2: 89,157,161 S5C probably damaging Het
Olfr1293-ps T A 2: 111,527,656 M132K probably damaging Het
Olfr948 T C 9: 39,318,778 T279A possibly damaging Het
Pappa T A 4: 65,156,464 D418E probably damaging Het
Pde4d G A 13: 109,601,786 probably null Het
Pip A G 6: 41,851,457 N75S possibly damaging Het
Plcl1 G C 1: 55,697,252 R584P probably benign Het
Pnp A T 14: 50,951,014 D237V probably damaging Het
Ppp1r12a T C 10: 108,262,420 W857R probably damaging Het
Pramef12 T C 4: 144,393,083 T305A possibly damaging Het
Ptchd3 A T 11: 121,836,403 M368L probably benign Het
Pum1 T A 4: 130,774,505 S868R probably damaging Het
R3hdml A T 2: 163,502,404 S238C probably damaging Het
Robo2 G A 16: 74,046,809 R173* probably null Het
Sall3 A G 18: 80,973,187 S509P possibly damaging Het
Sap130 T G 18: 31,666,365 H298Q possibly damaging Het
Selenov C A 7: 28,288,033 G307C probably damaging Het
Setd2 T A 9: 110,550,385 H1089Q possibly damaging Het
Setdb2 T C 14: 59,419,056 N287D probably damaging Het
Sis C T 3: 72,958,174 V182I probably benign Het
Slc32a1 A C 2: 158,611,537 D99A probably benign Het
Slk A G 19: 47,620,888 D760G probably damaging Het
Smg5 T A 3: 88,351,220 D499E probably benign Het
Stat3 T C 11: 100,889,574 T720A possibly damaging Het
Trdn T G 10: 33,139,114 N21K probably damaging Het
Trpm4 A T 7: 45,326,568 V118E possibly damaging Het
Vgll3 A G 16: 65,815,754 Q41R probably damaging Het
Vmn1r189 A G 13: 22,102,355 V104A probably damaging Het
Vmn1r46 A T 6: 89,976,407 R79S probably benign Het
Zscan4c T C 7: 11,006,929 M125T probably benign Het
Other mutations in Olfr406
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01370:Olfr406 APN 11 74269499 missense probably benign 0.01
IGL01480:Olfr406 APN 11 74269601 missense possibly damaging 0.64
IGL02138:Olfr406 APN 11 74269718 missense probably benign 0.01
IGL02986:Olfr406 APN 11 74270102 missense possibly damaging 0.82
R0018:Olfr406 UTSW 11 74270108 missense probably benign 0.39
R1822:Olfr406 UTSW 11 74270240 missense probably benign 0.11
R1823:Olfr406 UTSW 11 74270217 missense probably damaging 1.00
R1956:Olfr406 UTSW 11 74269844 missense probably damaging 1.00
R2017:Olfr406 UTSW 11 74270333 missense probably benign
R2879:Olfr406 UTSW 11 74270223 missense probably damaging 1.00
R3854:Olfr406 UTSW 11 74270279 nonsense probably null
R4750:Olfr406 UTSW 11 74269420 missense probably benign 0.00
R6076:Olfr406 UTSW 11 74270262 missense probably damaging 1.00
R6257:Olfr406 UTSW 11 74270007 missense probably damaging 1.00
R7032:Olfr406 UTSW 11 74269602 missense possibly damaging 0.95
R7216:Olfr406 UTSW 11 74269724 missense probably damaging 1.00
R7429:Olfr406 UTSW 11 74269753 missense probably damaging 1.00
R8144:Olfr406 UTSW 11 74269558 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TCTTCAGCAGGCTACATAAAGTGC -3'
(R):5'- TTGGGCACTATGGTGGAGAC -3'

Sequencing Primer
(F):5'- GCCCTATGCATATGCCAGATG -3'
(R):5'- TGTCATCACAGGACAGGCTG -3'
Posted On2018-05-24