Incidental Mutation 'R6431:Stat3'
ID518556
Institutional Source Beutler Lab
Gene Symbol Stat3
Ensembl Gene ENSMUSG00000004040
Gene Namesignal transducer and activator of transcription 3
Synonyms1110034C02Rik, Aprf
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6431 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location100885098-100939540 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 100889574 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 720 (T720A)
Ref Sequence ENSEMBL: ENSMUSP00000090342 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004145] [ENSMUST00000092671] [ENSMUST00000103114] [ENSMUST00000107356] [ENSMUST00000107357] [ENSMUST00000127638] [ENSMUST00000138438]
PDB Structure
TRANSCRIPTION FACTOR STAT3B/DNA COMPLEX [X-RAY DIFFRACTION]
Unphosphorylated mouse STAT3 core fragment [X-RAY DIFFRACTION]
Unphosphorylated STAT3B core protein binding to dsDNA [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000004145
SMART Domains Protein: ENSMUSP00000004145
Gene: ENSMUSG00000004043

DomainStartEndE-ValueType
STAT_int 2 126 4.42e-62 SMART
Pfam:STAT_alpha 138 330 6.9e-58 PFAM
Pfam:STAT_bind 332 583 2.4e-101 PFAM
SH2 587 688 7.64e-6 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000092671
AA Change: T720A

PolyPhen 2 Score 0.790 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000090342
Gene: ENSMUSG00000004040
AA Change: T720A

DomainStartEndE-ValueType
STAT_int 2 122 3.03e-60 SMART
Pfam:STAT_alpha 138 319 2.2e-62 PFAM
Pfam:STAT_bind 321 574 1.8e-130 PFAM
SH2 582 663 2.84e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000103114
SMART Domains Protein: ENSMUSP00000099403
Gene: ENSMUSG00000004040

DomainStartEndE-ValueType
STAT_int 2 122 3.03e-60 SMART
Pfam:STAT_alpha 138 319 7.2e-62 PFAM
Pfam:STAT_bind 321 574 5.7e-130 PFAM
SH2 582 663 2.84e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107356
SMART Domains Protein: ENSMUSP00000102979
Gene: ENSMUSG00000004043

DomainStartEndE-ValueType
STAT_int 2 126 4.42e-62 SMART
Pfam:STAT_alpha 138 330 6.9e-58 PFAM
Pfam:STAT_bind 332 583 2.4e-101 PFAM
SH2 587 688 7.64e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107357
SMART Domains Protein: ENSMUSP00000102980
Gene: ENSMUSG00000004043

DomainStartEndE-ValueType
STAT_int 2 126 4.42e-62 SMART
Pfam:STAT_alpha 141 330 4.5e-57 PFAM
Pfam:STAT_bind 332 582 1e-104 PFAM
SH2 587 688 1.55e-6 SMART
low complexity region 713 729 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000127638
AA Change: T721A

PolyPhen 2 Score 0.685 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000120152
Gene: ENSMUSG00000004040
AA Change: T721A

DomainStartEndE-ValueType
STAT_int 2 122 3.03e-60 SMART
Pfam:STAT_alpha 141 319 6.8e-59 PFAM
Pfam:STAT_bind 321 573 2.5e-80 PFAM
SH2 582 663 2.84e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137093
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137367
Predicted Effect possibly damaging
Transcript: ENSMUST00000138438
AA Change: T695A

PolyPhen 2 Score 0.685 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000121677
Gene: ENSMUSG00000004040
AA Change: T695A

DomainStartEndE-ValueType
STAT_int 2 123 5.47e-35 SMART
coiled coil region 171 195 N/A INTRINSIC
coiled coil region 243 265 N/A INTRINSIC
Pfam:STAT_bind 295 548 9.2e-131 PFAM
SH2 556 637 2.84e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146971
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151544
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152601
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155972
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156645
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.7%
  • 10x: 98.2%
  • 20x: 93.9%
Validation Efficiency 100% (68/68)
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the STAT protein family. In response to cytokines and growth factors, STAT family members are phosphorylated by the receptor associated kinases, and then form homo- or heterodimers that translocate to the cell nucleus where they act as transcription activators. This protein is activated through phosphorylation in response to various cytokines and growth factors including IFNs, EGF, IL5, IL6, HGF, LIF and BMP2. This protein mediates the expression of a variety of genes in response to cell stimuli, and thus plays a key role in many cellular processes such as cell growth and apoptosis. The small GTPase Rac1 has been shown to bind and regulate the activity of this protein. PIAS3 protein is a specific inhibitor of this protein. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygotes for targeted null mutations die at embryonic day 6.5-7.5. Conditional, tissue specific mutants are variably viable and show diverse defects including obesity, diabetes, thermal dysregulation and infertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik T A 1: 26,684,030 N690Y probably benign Het
Adcy5 A G 16: 35,279,237 E719G probably damaging Het
Ankdd1a A G 9: 65,516,938 M31T possibly damaging Het
Atp13a5 T C 16: 29,251,402 K911E possibly damaging Het
Bpifb3 G T 2: 153,924,808 L210F probably damaging Het
Cacna1c T C 6: 118,751,373 Y211C probably damaging Het
Carm1 C A 9: 21,583,077 P297T probably damaging Het
Cdh19 A T 1: 110,925,057 Y383N probably benign Het
Cfap221 T C 1: 119,932,853 H681R probably damaging Het
Cmya5 A C 13: 93,074,464 S3274A possibly damaging Het
Cndp2 T A 18: 84,675,078 K186* probably null Het
Ctdp1 G T 18: 80,451,255 F310L probably damaging Het
Cyp2c55 A T 19: 39,031,409 I264F probably damaging Het
Dhx40 A T 11: 86,773,823 F628I probably damaging Het
Disc1 T A 8: 125,135,389 M500K possibly damaging Het
Dnah5 A C 15: 28,349,824 D2551A possibly damaging Het
Esyt1 A G 10: 128,516,674 probably null Het
Fam78a T C 2: 32,082,831 S26G probably damaging Het
Fn1 G A 1: 71,647,844 probably null Het
Gbx1 T C 5: 24,504,918 T310A probably benign Het
Ggh T A 4: 20,042,219 C16S unknown Het
Gm11595 T A 11: 99,772,774 T27S unknown Het
Gm17334 T A 11: 53,772,738 probably benign Het
Gsk3b A G 16: 38,193,949 I256M probably damaging Het
Hmcn1 A T 1: 150,744,960 S1166R probably benign Het
Hyou1 T C 9: 44,382,025 probably null Het
Jup G T 11: 100,374,341 R637S probably benign Het
Lama2 T A 10: 27,053,031 I2087F possibly damaging Het
Lamc1 T G 1: 153,221,671 K1542N probably benign Het
Lgals4 G T 7: 28,840,692 Het
Lrrc8d A G 5: 105,811,760 D12G probably damaging Het
Lrwd1 C T 5: 136,133,034 V207M possibly damaging Het
Mbd1 T A 18: 74,273,691 probably null Het
Msi1 T A 5: 115,450,925 I333N probably damaging Het
Neo1 C T 9: 58,907,071 V871I probably benign Het
Nr2c1 T C 10: 94,188,216 C428R probably damaging Het
Ntm A G 9: 29,411,682 L14P probably damaging Het
Nxpe4 A T 9: 48,392,845 K77N probably damaging Het
Olfr1049 G A 2: 86,255,358 L112F probably benign Het
Olfr1224-ps1 T A 2: 89,157,161 S5C probably damaging Het
Olfr1293-ps T A 2: 111,527,656 M132K probably damaging Het
Olfr406 A C 11: 74,269,409 T7P possibly damaging Het
Olfr948 T C 9: 39,318,778 T279A possibly damaging Het
Pappa T A 4: 65,156,464 D418E probably damaging Het
Pde4d G A 13: 109,601,786 probably null Het
Pip A G 6: 41,851,457 N75S possibly damaging Het
Plcl1 G C 1: 55,697,252 R584P probably benign Het
Pnp A T 14: 50,951,014 D237V probably damaging Het
Ppp1r12a T C 10: 108,262,420 W857R probably damaging Het
Pramef12 T C 4: 144,393,083 T305A possibly damaging Het
Ptchd3 A T 11: 121,836,403 M368L probably benign Het
Pum1 T A 4: 130,774,505 S868R probably damaging Het
R3hdml A T 2: 163,502,404 S238C probably damaging Het
Robo2 G A 16: 74,046,809 R173* probably null Het
Sall3 A G 18: 80,973,187 S509P possibly damaging Het
Sap130 T G 18: 31,666,365 H298Q possibly damaging Het
Selenov C A 7: 28,288,033 G307C probably damaging Het
Setd2 T A 9: 110,550,385 H1089Q possibly damaging Het
Setdb2 T C 14: 59,419,056 N287D probably damaging Het
Sis C T 3: 72,958,174 V182I probably benign Het
Slc32a1 A C 2: 158,611,537 D99A probably benign Het
Slk A G 19: 47,620,888 D760G probably damaging Het
Smg5 T A 3: 88,351,220 D499E probably benign Het
Trdn T G 10: 33,139,114 N21K probably damaging Het
Trpm4 A T 7: 45,326,568 V118E possibly damaging Het
Vgll3 A G 16: 65,815,754 Q41R probably damaging Het
Vmn1r189 A G 13: 22,102,355 V104A probably damaging Het
Vmn1r46 A T 6: 89,976,407 R79S probably benign Het
Zscan4c T C 7: 11,006,929 M125T probably benign Het
Other mutations in Stat3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01720:Stat3 APN 11 100903658 missense possibly damaging 0.77
IGL02289:Stat3 APN 11 100905894 missense possibly damaging 0.82
IGL03183:Stat3 APN 11 100902756 missense possibly damaging 0.71
Cunegonde UTSW 11 100898633 missense probably damaging 0.99
Pangloss UTSW 11 100893670 missense possibly damaging 0.92
Stamatios UTSW 11 100893230 missense probably damaging 1.00
Voltaire UTSW 11 100911267 missense probably damaging 0.99
R0143:Stat3 UTSW 11 100895156 missense possibly damaging 0.89
R0395:Stat3 UTSW 11 100889937 splice site probably benign
R0487:Stat3 UTSW 11 100903643 missense probably damaging 1.00
R0589:Stat3 UTSW 11 100908083 missense probably damaging 0.97
R0800:Stat3 UTSW 11 100894155 splice site probably benign
R1393:Stat3 UTSW 11 100888765 splice site probably null
R1927:Stat3 UTSW 11 100894829 missense probably damaging 1.00
R3819:Stat3 UTSW 11 100898633 missense probably damaging 0.99
R4037:Stat3 UTSW 11 100893125 missense probably damaging 1.00
R4391:Stat3 UTSW 11 100905552 intron probably benign
R4598:Stat3 UTSW 11 100903674 missense probably damaging 1.00
R4637:Stat3 UTSW 11 100893230 missense probably damaging 1.00
R5479:Stat3 UTSW 11 100889888 unclassified probably benign
R5909:Stat3 UTSW 11 100903730 missense probably benign 0.00
R5930:Stat3 UTSW 11 100893670 missense possibly damaging 0.92
R5944:Stat3 UTSW 11 100895105 missense probably damaging 1.00
R6002:Stat3 UTSW 11 100903743 missense probably benign 0.01
R6816:Stat3 UTSW 11 100911267 missense probably damaging 0.99
X0033:Stat3 UTSW 11 100893092 missense probably benign
Z1176:Stat3 UTSW 11 100911278 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- CGATTTCTACCAGTGTGGATGGC -3'
(R):5'- AGAGTTACCGTGAAGGGCTG -3'

Sequencing Primer
(F):5'- AGTGTGGATGGCAGGCC -3'
(R):5'- TGTGTCTTGTCAACCTGG -3'
Posted On2018-05-24