Mutagenetix > Incidental Mutation

Incidental Mutation 'R6431:Setdb2'

518561

Institutional Source

Beutler Lab

Gene Symbol

Setdb2

Ensembl Gene

ENSMUSG00000071350

Gene Name

SET domain, bifurcated 2

Synonyms

KMT1F, LOC239122

MMRRC Submission

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.510) question?

Stock #

R6431 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

59402009-59440884 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 59419056 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Aspartic acid at position 287 (N287D)

Ref Sequence

ENSEMBL: ENSMUSP00000093450 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000095775] [ENSMUST00000111253] [ENSMUST00000161459]

AlphaFold

Q8C267

Predicted Effect

probably damaging
Transcript: ENSMUST00000095775
AA Change: N287D

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000093450
Gene: ENSMUSG00000071350
AA Change: N287D

Domain	Start	End	E-Value	Type
Pfam:MBD	164	236	3.4e-10	PFAM
Pfam:Pre-SET	250	362	1.7e-17	PFAM
SET	370	694	9.33e-32	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000111253

Predicted Effect

probably benign
Transcript: ENSMUST00000161459
AA Change: N271D

PolyPhen 2 Score 0.279 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000124696
Gene: ENSMUSG00000071350
AA Change: N271D

Domain	Start	End	E-Value	Type
Pfam:MBD	148	220	2.7e-9	PFAM
Pfam:Pre-SET	233	346	1.3e-19	PFAM
SET	354	678	9.33e-32	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000161959

Meta Mutation Damage Score

0.2332

Coding Region Coverage

1x: 100.0%
3x: 99.7%
10x: 98.2%
20x: 93.9%

Validation Efficiency

100% (68/68)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of proteins that contain a methyl-CpG-binding domain (MBD) and a SET domain and function as histone methyltransferases. This protein is recruited to heterochromatin and plays a role in the regulation of chromosome segregation. This region is commonly deleted in chronic lymphocytic leukemia. Naturally-occuring readthrough transcription occurs from this gene to the downstream PHF11 (PHD finger protein 11) gene. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2016]
PHENOTYPE: Mice homozygous for a hypomorphic allele exhibit altered response to infection and improved patology following superinfection of influenza virus-infected mice with S. pneumonia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 69 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931408C20Rik	T	A	1: 26,684,030	N690Y	probably benign	Het
Adcy5	A	G	16: 35,279,237	E719G	probably damaging	Het
Ankdd1a	A	G	9: 65,516,938	M31T	possibly damaging	Het
Atp13a5	T	C	16: 29,251,402	K911E	possibly damaging	Het
Bpifb3	G	T	2: 153,924,808	L210F	probably damaging	Het
Cacna1c	T	C	6: 118,751,373	Y211C	probably damaging	Het
Carm1	C	A	9: 21,583,077	P297T	probably damaging	Het
Cdh19	A	T	1: 110,925,057	Y383N	probably benign	Het
Cfap221	T	C	1: 119,932,853	H681R	probably damaging	Het
Cmya5	A	C	13: 93,074,464	S3274A	possibly damaging	Het
Cndp2	T	A	18: 84,675,078	K186*	probably null	Het
Ctdp1	G	T	18: 80,451,255	F310L	probably damaging	Het
Cyp2c55	A	T	19: 39,031,409	I264F	probably damaging	Het
Dhx40	A	T	11: 86,773,823	F628I	probably damaging	Het
Disc1	T	A	8: 125,135,389	M500K	possibly damaging	Het
Dnah5	A	C	15: 28,349,824	D2551A	possibly damaging	Het
Esyt1	A	G	10: 128,516,674		probably null	Het
Fam78a	T	C	2: 32,082,831	S26G	probably damaging	Het
Fn1	G	A	1: 71,647,844		probably null	Het
Gbx1	T	C	5: 24,504,918	T310A	probably benign	Het
Ggh	T	A	4: 20,042,219	C16S	unknown	Het
Gm11595	T	A	11: 99,772,774	T27S	unknown	Het
Gm17334	T	A	11: 53,772,738		probably benign	Het
Gsk3b	A	G	16: 38,193,949	I256M	probably damaging	Het
Hmcn1	A	T	1: 150,744,960	S1166R	probably benign	Het
Hyou1	T	C	9: 44,382,025		probably null	Het
Jup	G	T	11: 100,374,341	R637S	probably benign	Het
Lama2	T	A	10: 27,053,031	I2087F	possibly damaging	Het
Lamc1	T	G	1: 153,221,671	K1542N	probably benign	Het
Lgals4	G	T	7: 28,840,692			Het
Lrrc8d	A	G	5: 105,811,760	D12G	probably damaging	Het
Lrwd1	C	T	5: 136,133,034	V207M	possibly damaging	Het
Mbd1	T	A	18: 74,273,691		probably null	Het
Msi1	T	A	5: 115,450,925	I333N	probably damaging	Het
Neo1	C	T	9: 58,907,071	V871I	probably benign	Het
Nr2c1	T	C	10: 94,188,216	C428R	probably damaging	Het
Ntm	A	G	9: 29,411,682	L14P	probably damaging	Het
Nxpe4	A	T	9: 48,392,845	K77N	probably damaging	Het
Olfr1049	G	A	2: 86,255,358	L112F	probably benign	Het
Olfr1224-ps1	T	A	2: 89,157,161	S5C	probably damaging	Het
Olfr1293-ps	T	A	2: 111,527,656	M132K	probably damaging	Het
Olfr406	A	C	11: 74,269,409	T7P	possibly damaging	Het
Olfr948	T	C	9: 39,318,778	T279A	possibly damaging	Het
Pappa	T	A	4: 65,156,464	D418E	probably damaging	Het
Pde4d	G	A	13: 109,601,786		probably null	Het
Pip	A	G	6: 41,851,457	N75S	possibly damaging	Het
Plcl1	G	C	1: 55,697,252	R584P	probably benign	Het
Pnp	A	T	14: 50,951,014	D237V	probably damaging	Het
Ppp1r12a	T	C	10: 108,262,420	W857R	probably damaging	Het
Pramef12	T	C	4: 144,393,083	T305A	possibly damaging	Het
Ptchd3	A	T	11: 121,836,403	M368L	probably benign	Het
Pum1	T	A	4: 130,774,505	S868R	probably damaging	Het
R3hdml	A	T	2: 163,502,404	S238C	probably damaging	Het
Robo2	G	A	16: 74,046,809	R173*	probably null	Het
Sall3	A	G	18: 80,973,187	S509P	possibly damaging	Het
Sap130	T	G	18: 31,666,365	H298Q	possibly damaging	Het
Selenov	C	A	7: 28,288,033	G307C	probably damaging	Het
Setd2	T	A	9: 110,550,385	H1089Q	possibly damaging	Het
Sis	C	T	3: 72,958,174	V182I	probably benign	Het
Slc32a1	A	C	2: 158,611,537	D99A	probably benign	Het
Slk	A	G	19: 47,620,888	D760G	probably damaging	Het
Smg5	T	A	3: 88,351,220	D499E	probably benign	Het
Stat3	T	C	11: 100,889,574	T720A	possibly damaging	Het
Trdn	T	G	10: 33,139,114	N21K	probably damaging	Het
Trpm4	A	T	7: 45,326,568	V118E	possibly damaging	Het
Vgll3	A	G	16: 65,815,754	Q41R	probably damaging	Het
Vmn1r189	A	G	13: 22,102,355	V104A	probably damaging	Het
Vmn1r46	A	T	6: 89,976,407	R79S	probably benign	Het
Zscan4c	T	C	7: 11,006,929	M125T	probably benign	Het

Other mutations in Setdb2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00553:Setdb2	APN	14	59415792	missense	probably damaging	1.00
IGL01695:Setdb2	APN	14	59402293	utr 3 prime	probably benign
IGL01720:Setdb2	APN	14	59423436	missense	possibly damaging	0.76
IGL02003:Setdb2	APN	14	59413490	missense	probably damaging	0.98
IGL02023:Setdb2	APN	14	59431158	missense	probably damaging	1.00
IGL02108:Setdb2	APN	14	59402315	missense	probably damaging	1.00
IGL02113:Setdb2	APN	14	59402315	missense	probably damaging	1.00
IGL02114:Setdb2	APN	14	59402315	missense	probably damaging	1.00
IGL02115:Setdb2	APN	14	59402315	missense	probably damaging	1.00
IGL02116:Setdb2	APN	14	59402315	missense	probably damaging	1.00
IGL02117:Setdb2	APN	14	59402315	missense	probably damaging	1.00
IGL02141:Setdb2	APN	14	59402315	missense	probably damaging	1.00
IGL02148:Setdb2	APN	14	59402315	missense	probably damaging	1.00
R0419:Setdb2	UTSW	14	59406744	splice site	probably null
R0610:Setdb2	UTSW	14	59417470	missense	possibly damaging	0.55
R0636:Setdb2	UTSW	14	59406704	missense	probably benign	0.40
R0890:Setdb2	UTSW	14	59419220	missense	possibly damaging	0.89
R0931:Setdb2	UTSW	14	59423496	splice site	probably benign
R1355:Setdb2	UTSW	14	59417441	missense	probably damaging	1.00
R1553:Setdb2	UTSW	14	59417485	missense	probably benign	0.04
R1968:Setdb2	UTSW	14	59419409	missense	probably damaging	1.00
R2472:Setdb2	UTSW	14	59419454	missense	possibly damaging	0.49
R2894:Setdb2	UTSW	14	59426467	missense	probably benign	0.00
R3919:Setdb2	UTSW	14	59419167	missense	probably damaging	1.00
R4609:Setdb2	UTSW	14	59415704	missense	probably damaging	1.00
R4629:Setdb2	UTSW	14	59409359	missense	probably benign	0.13
R4816:Setdb2	UTSW	14	59413646	missense	probably benign	0.05
R4864:Setdb2	UTSW	14	59409266	missense	probably benign	0.01
R4951:Setdb2	UTSW	14	59402303	missense	possibly damaging	0.72
R5040:Setdb2	UTSW	14	59415707	missense	probably damaging	0.99
R5245:Setdb2	UTSW	14	59426494	missense	probably null	0.00
R5358:Setdb2	UTSW	14	59409436	missense	probably benign	0.17
R5656:Setdb2	UTSW	14	59419118	missense	probably damaging	1.00
R5705:Setdb2	UTSW	14	59423365	missense	possibly damaging	0.80
R6103:Setdb2	UTSW	14	59409532	splice site	probably null
R6106:Setdb2	UTSW	14	59423449	nonsense	probably null
R6388:Setdb2	UTSW	14	59424697	missense	probably benign
R6494:Setdb2	UTSW	14	59402414	missense	probably benign	0.12
R6971:Setdb2	UTSW	14	59415740	missense	probably damaging	1.00
R7442:Setdb2	UTSW	14	59419251	missense	probably damaging	0.99
R7444:Setdb2	UTSW	14	59423345	nonsense	probably null
R7759:Setdb2	UTSW	14	59419364	missense	probably damaging	1.00
R8021:Setdb2	UTSW	14	59423384	nonsense	probably null
R8039:Setdb2	UTSW	14	59402375	missense	probably damaging	1.00
R8261:Setdb2	UTSW	14	59413692	splice site	probably benign
R8393:Setdb2	UTSW	14	59412731	missense	probably benign	0.04
R8513:Setdb2	UTSW	14	59402390	missense	probably damaging	1.00
R8700:Setdb2	UTSW	14	59417439	missense	probably damaging	1.00
R8707:Setdb2	UTSW	14	59423458	nonsense	probably null
R8940:Setdb2	UTSW	14	59409507	missense	probably damaging	1.00
R9217:Setdb2	UTSW	14	59409432	missense	possibly damaging	0.61
R9314:Setdb2	UTSW	14	59412791	missense	probably benign	0.02
R9336:Setdb2	UTSW	14	59423367	missense	unknown
R9442:Setdb2	UTSW	14	59402400	missense	probably damaging	1.00
R9525:Setdb2	UTSW	14	59409392	missense	probably benign	0.00
R9743:Setdb2	UTSW	14	59413553	missense	probably benign	0.00
X0017:Setdb2	UTSW	14	59419468	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTGCAAATAGCCACTTTGGGG -3'
(R):5'- ACTTATGTCCAGTTGACTCGG -3'

Sequencing Primer
(F):5'- CCACTTTGGGGAGTTATGAAAC -3'
(R):5'- ATGTCCAGTTGACTCGGAATCAC -3'

Posted On

2018-05-24