Incidental Mutation 'R6432:Cass4'
ID518581
Institutional Source Beutler Lab
Gene Symbol Cass4
Ensembl Gene ENSMUSG00000074570
Gene NameCas scaffolding protein family member 4
SynonymsF730031O20Rik
MMRRC Submission
Accession Numbers

Ncbi RefSeq: NM_001033538.2, NM_001080820.1; MGI:2444482

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6432 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location172393794-172433757 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 172427719 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 574 (F574L)
Ref Sequence ENSEMBL: ENSMUSP00000099362 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099061] [ENSMUST00000103073] [ENSMUST00000109136] [ENSMUST00000228775]
Predicted Effect probably benign
Transcript: ENSMUST00000099061
AA Change: F574L

PolyPhen 2 Score 0.164 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000096660
Gene: ENSMUSG00000074570
AA Change: F574L

DomainStartEndE-ValueType
SH3 14 72 5.65e-16 SMART
low complexity region 392 428 N/A INTRINSIC
Pfam:Serine_rich 433 591 4.2e-68 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000103073
AA Change: F574L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099362
Gene: ENSMUSG00000074570
AA Change: F574L

DomainStartEndE-ValueType
SH3 14 72 5.65e-16 SMART
low complexity region 392 428 N/A INTRINSIC
Pfam:Serine_rich 433 591 7.5e-69 PFAM
Pfam:DUF3513 587 778 8.8e-60 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109136
AA Change: F574L

PolyPhen 2 Score 0.164 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000104764
Gene: ENSMUSG00000074570
AA Change: F574L

DomainStartEndE-ValueType
SH3 14 72 5.65e-16 SMART
low complexity region 392 428 N/A INTRINSIC
Pfam:Serine_rich 433 589 3.8e-58 PFAM
Pfam:DUF3513 593 803 1.6e-51 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138288
Predicted Effect possibly damaging
Transcript: ENSMUST00000228775
AA Change: F576L

PolyPhen 2 Score 0.941 (Sensitivity: 0.80; Specificity: 0.94)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.3%
Validation Efficiency 100% (42/42)
Allele List at MGI

All alleles(2) : Targeted(2)

Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010109I03Rik T C 15: 74,879,964 T74A probably benign Het
5430419D17Rik G A 7: 131,244,872 probably null Het
Adora3 T A 3: 105,907,675 L101* probably null Het
Atf7ip2 T C 16: 10,204,670 I71T probably damaging Het
Atp2c1 A G 9: 105,445,313 C206R probably damaging Het
Cacna1d A G 14: 30,123,454 L606P probably damaging Het
Col17a1 C A 19: 47,680,408 E126* probably null Het
Cxadr A C 16: 78,325,259 D49A probably damaging Het
Dact1 T C 12: 71,318,553 S703P probably damaging Het
Dchs2 T A 3: 83,271,118 H1159Q possibly damaging Het
Dnmt3a T A 12: 3,902,399 F697I probably damaging Het
Dnpep T A 1: 75,315,378 K199N probably benign Het
Ear2 G T 14: 44,103,203 C106F probably damaging Het
Gnl2 A T 4: 125,052,560 I525F possibly damaging Het
Hsph1 C A 5: 149,618,976 K692N probably damaging Het
Itga6 T A 2: 71,833,772 C489S possibly damaging Het
Kdm2b C T 5: 122,880,191 C1007Y probably damaging Het
Mast4 T C 13: 102,905,677 S22G possibly damaging Het
Ms4a12 A G 19: 11,215,012 *264Q probably null Het
Myh8 G T 11: 67,298,579 A1194S probably benign Het
Ncapd3 T A 9: 27,044,509 N131K probably damaging Het
Olfr1136 A T 2: 87,693,528 M118K probably damaging Het
Olfr981 T C 9: 40,022,528 I45T probably damaging Het
Rbm14 G T 19: 4,803,163 probably benign Het
Rnf130 T A 11: 50,095,790 C320* probably null Het
Rnf5 A G 17: 34,602,127 V77A possibly damaging Het
Sh3pxd2a G T 19: 47,269,927 P418T probably damaging Het
Shank3 G T 15: 89,503,413 V262F possibly damaging Het
Six5 T A 7: 19,096,771 V441E probably damaging Het
Tbc1d9b T A 11: 50,146,328 I268N probably benign Het
Terb1 G A 8: 104,485,446 T301I possibly damaging Het
Tnxb A C 17: 34,717,917 D2820A probably damaging Het
Tram2 C T 1: 21,004,233 E242K possibly damaging Het
Trps1 T C 15: 50,831,397 K210E probably damaging Het
Tulp2 T A 7: 45,518,588 D141E probably benign Het
Umodl1 C T 17: 30,986,147 T572I probably benign Het
Upf2 C A 2: 5,979,777 A501E unknown Het
Vmn2r102 A G 17: 19,681,221 T537A possibly damaging Het
Wdr11 T A 7: 129,606,518 D332E possibly damaging Het
Wdr38 A G 2: 39,000,711 N199S probably damaging Het
Zfp672 T A 11: 58,316,932 I188F possibly damaging Het
Other mutations in Cass4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00433:Cass4 APN 2 172416250 missense probably damaging 1.00
IGL00846:Cass4 APN 2 172429723 intron probably benign
IGL01400:Cass4 APN 2 172427300 missense probably damaging 1.00
IGL01985:Cass4 APN 2 172427206 missense probably damaging 1.00
IGL02268:Cass4 APN 2 172427042 missense possibly damaging 0.76
IGL02592:Cass4 APN 2 172416328 missense probably benign 0.00
R0030:Cass4 UTSW 2 172427842 nonsense probably null
R0035:Cass4 UTSW 2 172416492 missense probably damaging 1.00
R0039:Cass4 UTSW 2 172426980 missense probably damaging 1.00
R0631:Cass4 UTSW 2 172432411 missense probably damaging 1.00
R1321:Cass4 UTSW 2 172424652 missense probably benign 0.05
R1352:Cass4 UTSW 2 172416495 missense probably damaging 0.98
R1612:Cass4 UTSW 2 172427078 missense possibly damaging 0.46
R1720:Cass4 UTSW 2 172427734 missense probably damaging 0.99
R1776:Cass4 UTSW 2 172427695 missense probably benign
R1918:Cass4 UTSW 2 172427339 missense possibly damaging 0.69
R2257:Cass4 UTSW 2 172427470 missense probably damaging 1.00
R2257:Cass4 UTSW 2 172432558 missense probably damaging 1.00
R2262:Cass4 UTSW 2 172427254 missense probably damaging 1.00
R2924:Cass4 UTSW 2 172426672 missense possibly damaging 0.89
R3498:Cass4 UTSW 2 172432558 missense probably damaging 1.00
R3499:Cass4 UTSW 2 172432558 missense probably damaging 1.00
R3792:Cass4 UTSW 2 172432558 missense probably damaging 1.00
R3793:Cass4 UTSW 2 172432558 missense probably damaging 1.00
R3901:Cass4 UTSW 2 172432558 missense probably damaging 1.00
R4899:Cass4 UTSW 2 172427869 missense probably benign
R5161:Cass4 UTSW 2 172432324 missense probably damaging 1.00
R5534:Cass4 UTSW 2 172426768 missense probably benign 0.13
R5646:Cass4 UTSW 2 172416245 missense probably damaging 1.00
R5799:Cass4 UTSW 2 172416187 missense probably damaging 1.00
R5873:Cass4 UTSW 2 172426768 missense probably benign 0.13
R6084:Cass4 UTSW 2 172426912 missense probably benign 0.01
R6360:Cass4 UTSW 2 172432611 missense probably damaging 1.00
R7116:Cass4 UTSW 2 172427969 missense unknown
R7212:Cass4 UTSW 2 172427186 nonsense probably null
R7549:Cass4 UTSW 2 172426798 missense probably benign 0.01
R7549:Cass4 UTSW 2 172426799 missense probably benign 0.00
R7594:Cass4 UTSW 2 172429648 missense probably benign 0.03
R7659:Cass4 UTSW 2 172427027 missense probably damaging 1.00
R8003:Cass4 UTSW 2 172427959 missense unknown
R8270:Cass4 UTSW 2 172427669 missense probably damaging 1.00
R8296:Cass4 UTSW 2 172427174 missense probably benign 0.28
R8378:Cass4 UTSW 2 172427794 missense probably benign 0.05
Z1177:Cass4 UTSW 2 172427575 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACCGCTTGCAATCTCACAG -3'
(R):5'- TCCTTGCTAGTTCAAAGGAGTG -3'

Sequencing Primer
(F):5'- CAGCTACCTTCAGGCTAGAATTAGAG -3'
(R):5'- CCTTGCTAGTTCAAAGGAGTGTTCAG -3'
Posted On2018-05-24