Incidental Mutation 'R6433:Dnpep'
ID518618
Institutional Source Beutler Lab
Gene Symbol Dnpep
Ensembl Gene ENSMUSG00000026209
Gene Nameaspartyl aminopeptidase
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6433 (G1)
Quality Score183.009
Status Validated
Chromosome1
Chromosomal Location75307896-75317990 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 75315378 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 199 (K199N)
Ref Sequence ENSEMBL: ENSMUSP00000140877 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066668] [ENSMUST00000113605] [ENSMUST00000185419] [ENSMUST00000185797] [ENSMUST00000187000] [ENSMUST00000187075] [ENSMUST00000187836] [ENSMUST00000188652] [ENSMUST00000189282] [ENSMUST00000189551] [ENSMUST00000191254]
Predicted Effect probably benign
Transcript: ENSMUST00000066668
AA Change: K199N

PolyPhen 2 Score 0.115 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000070821
Gene: ENSMUSG00000026209
AA Change: K199N

DomainStartEndE-ValueType
Pfam:Peptidase_M18 22 460 2.9e-199 PFAM
Pfam:Peptidase_M42 328 455 1.2e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113605
AA Change: K199N

PolyPhen 2 Score 0.115 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000109235
Gene: ENSMUSG00000026209
AA Change: K199N

DomainStartEndE-ValueType
Pfam:Peptidase_M18 22 460 9.4e-194 PFAM
Pfam:Peptidase_M42 328 455 1.1e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000185419
AA Change: K199N

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000140035
Gene: ENSMUSG00000026209
AA Change: K199N

DomainStartEndE-ValueType
Pfam:Peptidase_M18 22 459 7.3e-192 PFAM
Pfam:Peptidase_M42 328 455 1.1e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000185797
AA Change: K201N

PolyPhen 2 Score 0.056 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000140864
Gene: ENSMUSG00000026209
AA Change: K201N

DomainStartEndE-ValueType
Pfam:Peptidase_M18 24 462 2e-190 PFAM
Pfam:Peptidase_M42 330 457 1.9e-4 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186278
Predicted Effect probably benign
Transcript: ENSMUST00000187000
AA Change: K199N

PolyPhen 2 Score 0.056 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000141014
Gene: ENSMUSG00000026209
AA Change: K199N

DomainStartEndE-ValueType
Pfam:Peptidase_M18 22 271 2.9e-102 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000187075
AA Change: K199N

PolyPhen 2 Score 0.119 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000140877
Gene: ENSMUSG00000026209
AA Change: K199N

DomainStartEndE-ValueType
Pfam:Peptidase_M18 22 222 1.1e-80 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187791
Predicted Effect probably benign
Transcript: ENSMUST00000187836
AA Change: K199N

PolyPhen 2 Score 0.115 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000139739
Gene: ENSMUSG00000026209
AA Change: K199N

DomainStartEndE-ValueType
Pfam:Peptidase_M18 22 460 9.4e-194 PFAM
Pfam:Peptidase_M42 328 455 1.1e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000188652
SMART Domains Protein: ENSMUSP00000139532
Gene: ENSMUSG00000026209

DomainStartEndE-ValueType
Pfam:Peptidase_M18 22 85 4.4e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000189282
SMART Domains Protein: ENSMUSP00000141187
Gene: ENSMUSG00000026209

DomainStartEndE-ValueType
Pfam:Peptidase_M18 22 57 1.3e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000189551
SMART Domains Protein: ENSMUSP00000140563
Gene: ENSMUSG00000026209

DomainStartEndE-ValueType
Pfam:Peptidase_M18 22 198 6.4e-75 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190005
Predicted Effect probably benign
Transcript: ENSMUST00000191254
SMART Domains Protein: ENSMUSP00000140997
Gene: ENSMUSG00000026209

DomainStartEndE-ValueType
Pfam:Peptidase_M18 24 64 8.8e-11 PFAM
Pfam:Peptidase_M18 60 92 3.6e-8 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.6%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an aminopeptidase which prefers acidic amino acids, and specifically favors aspartic acid over glutamic acid. It is thought to be a cytosolic protein involved in general metabolism of intracellular proteins. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2016]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afdn T A 17: 13,881,299 D1016E probably damaging Het
Aplnr A T 2: 85,136,673 Q14L probably benign Het
Aspm T C 1: 139,473,683 L1147S probably damaging Het
Atad2b A G 12: 4,952,642 T337A possibly damaging Het
Atrn A G 2: 131,023,027 E1358G probably damaging Het
Caml C A 13: 55,623,249 S53R possibly damaging Het
Cd180 T G 13: 102,705,633 S396A probably benign Het
Cdhr2 A G 13: 54,718,512 T344A probably damaging Het
Cyp4a31 A C 4: 115,570,269 D224A probably damaging Het
Dhx36 T C 3: 62,484,974 T544A probably damaging Het
Dnah14 A G 1: 181,651,657 K1528E probably damaging Het
Dsc2 C T 18: 20,051,175 probably null Het
Efl1 T A 7: 82,674,568 D239E probably damaging Het
Elovl4 A G 9: 83,785,178 V42A possibly damaging Het
Exoc3 T C 13: 74,189,187 T432A possibly damaging Het
Fam98c A G 7: 29,156,128 probably null Het
Fbln2 G A 6: 91,233,272 G66D probably damaging Het
Fchsd1 G A 18: 37,964,084 T410I possibly damaging Het
Flcn T C 11: 59,801,082 D247G probably damaging Het
Galnt16 T C 12: 80,575,903 V127A probably benign Het
H2-Ob A T 17: 34,243,886 probably null Het
Has2 G A 15: 56,667,798 S507F possibly damaging Het
Ido2 T A 8: 24,533,923 M300L probably damaging Het
Itga10 T C 3: 96,658,041 probably null Het
Klra9 G T 6: 130,179,032 Y253* probably null Het
Mfsd2a A G 4: 122,950,457 V299A probably benign Het
Mybpc1 T C 10: 88,560,355 D210G probably damaging Het
Ndrg1 A T 15: 66,933,872 M128K probably damaging Het
Obscn T A 11: 59,051,558 T5091S probably benign Het
Olfr137 A G 17: 38,305,413 L16P probably damaging Het
Pex5 A T 6: 124,413,613 M91K possibly damaging Het
Phlpp2 G T 8: 109,934,685 A810S probably benign Het
Pla2g7 G C 17: 43,599,126 A174P probably damaging Het
Plxna4 C T 6: 32,215,678 V783M probably damaging Het
Poll A T 19: 45,553,604 M421K probably benign Het
Ppfia2 C A 10: 106,913,698 S1148R possibly damaging Het
Prkg1 A G 19: 30,781,346 F280S probably benign Het
Rdh10 G A 1: 16,107,855 C117Y probably damaging Het
Rtl1 C A 12: 109,595,196 A70S unknown Het
Scgb2b3 A T 7: 31,359,067 L104I probably benign Het
Sh3tc1 T C 5: 35,706,597 R749G probably damaging Het
Skint4 A G 4: 112,146,510 K380R probably benign Het
Smtnl1 A C 2: 84,818,368 S181A probably benign Het
Spata31d1b T C 13: 59,717,185 S716P probably damaging Het
Spc25 A G 2: 69,206,102 probably benign Het
Stab2 C T 10: 86,901,567 probably null Het
Timm22 T C 11: 76,409,744 V114A possibly damaging Het
Timp4 A G 6: 115,247,220 C163R probably damaging Het
Toporsl T A 4: 52,611,548 N480K possibly damaging Het
Tpo T C 12: 30,084,754 E735G probably benign Het
Trpm3 A G 19: 22,901,305 D692G probably damaging Het
Ttn T C 2: 76,751,714 H22945R probably damaging Het
Vmn2r6 A T 3: 64,547,380 Y499* probably null Het
Vwa1 G A 4: 155,772,769 H191Y probably benign Het
Other mutations in Dnpep
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02419:Dnpep APN 1 75315688 missense probably damaging 1.00
P0026:Dnpep UTSW 1 75308685 missense probably benign 0.01
R0126:Dnpep UTSW 1 75312538 nonsense probably null
R0318:Dnpep UTSW 1 75316626 missense probably damaging 1.00
R0669:Dnpep UTSW 1 75311778 unclassified probably benign
R1076:Dnpep UTSW 1 75315938 unclassified probably benign
R1478:Dnpep UTSW 1 75316027 missense probably damaging 1.00
R1803:Dnpep UTSW 1 75309414 nonsense probably null
R3409:Dnpep UTSW 1 75316626 missense probably damaging 1.00
R3411:Dnpep UTSW 1 75316626 missense probably damaging 1.00
R4590:Dnpep UTSW 1 75316401 missense probably damaging 1.00
R4863:Dnpep UTSW 1 75309230 intron probably benign
R4948:Dnpep UTSW 1 75316760 missense probably benign 0.13
R5873:Dnpep UTSW 1 75315143 missense probably damaging 1.00
R5891:Dnpep UTSW 1 75311812 missense probably benign
R5907:Dnpep UTSW 1 75311991 critical splice donor site probably null
R6143:Dnpep UTSW 1 75315228 missense probably damaging 1.00
R6432:Dnpep UTSW 1 75315378 missense probably benign 0.12
R7188:Dnpep UTSW 1 75316057 missense probably damaging 1.00
R7189:Dnpep UTSW 1 75313430 missense probably damaging 1.00
R7620:Dnpep UTSW 1 75313448 missense probably benign 0.02
R7682:Dnpep UTSW 1 75316740 missense probably damaging 1.00
R7770:Dnpep UTSW 1 75317246 intron probably benign
R8214:Dnpep UTSW 1 75315998 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTACAGCCACTCCTTACTGCAG -3'
(R):5'- CACCCCTTAGTGGTCAAGTTCC -3'

Sequencing Primer
(F):5'- TCCATGATGCTGTCAGGACTCAG -3'
(R):5'- CACGTTTGGAAACCAGTTCTATC -3'
Posted On2018-05-24