Incidental Mutation 'R6433:Spc25'
ID518621
Institutional Source Beutler Lab
Gene Symbol Spc25
Ensembl Gene ENSMUSG00000005233
Gene NameSPC25, NDC80 kinetochore complex component, homolog (S. cerevisiae)
Synonyms2600017H08Rik, Spbc25, 2610205L13Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.963) question?
Stock #R6433 (G1)
Quality Score196.009
Status Validated
Chromosome2
Chromosomal Location69193895-69206194 bp(-) (GRCm38)
Type of Mutationutr 5 prime
DNA Base Change (assembly) A to G at 69206102 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000128039 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005365] [ENSMUST00000112320] [ENSMUST00000127243] [ENSMUST00000149045] [ENSMUST00000149643] [ENSMUST00000167875]
Predicted Effect probably benign
Transcript: ENSMUST00000005365
SMART Domains Protein: ENSMUSP00000005365
Gene: ENSMUSG00000005233

DomainStartEndE-ValueType
low complexity region 46 57 N/A INTRINSIC
Pfam:Spindle_Spc25 148 222 6.3e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000112320
SMART Domains Protein: ENSMUSP00000107939
Gene: ENSMUSG00000005233

DomainStartEndE-ValueType
low complexity region 46 57 N/A INTRINSIC
Pfam:Spindle_Spc25 150 221 1.3e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126638
Predicted Effect unknown
Transcript: ENSMUST00000127243
AA Change: V19A
SMART Domains Protein: ENSMUSP00000120142
Gene: ENSMUSG00000005233
AA Change: V19A

DomainStartEndE-ValueType
low complexity region 1 12 N/A INTRINSIC
low complexity region 30 44 N/A INTRINSIC
coiled coil region 57 113 N/A INTRINSIC
Pfam:Spindle_Spc25 133 207 4.5e-24 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129288
Predicted Effect probably benign
Transcript: ENSMUST00000149045
SMART Domains Protein: ENSMUSP00000120999
Gene: ENSMUSG00000005233

DomainStartEndE-ValueType
Pfam:Spindle_Spc25 100 133 3.7e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149401
Predicted Effect probably benign
Transcript: ENSMUST00000149643
SMART Domains Protein: ENSMUSP00000117415
Gene: ENSMUSG00000005233

DomainStartEndE-ValueType
low complexity region 46 57 N/A INTRINSIC
PDB:3IZ0|E 99 167 3e-22 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150505
Predicted Effect probably benign
Transcript: ENSMUST00000167875
SMART Domains Protein: ENSMUSP00000128039
Gene: ENSMUSG00000005233

DomainStartEndE-ValueType
Pfam:Spindle_Spc25 100 174 1.7e-27 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.6%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: This gene encodes a component of the kinetochore-associated NDC80 protein complex, which is required for the mitotic spindle checkpoint and for microtubule-kinetochore attachment. During meiosis in mouse, the protein localizes to the germinal vesicle and then is associated with the chromosomes following germinal vesicle breakdown. Knockdown of this gene in oocytes results in precocious polar body extrusion, chromosome misalignment and aberrant spindle formation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afdn T A 17: 13,881,299 D1016E probably damaging Het
Aplnr A T 2: 85,136,673 Q14L probably benign Het
Aspm T C 1: 139,473,683 L1147S probably damaging Het
Atad2b A G 12: 4,952,642 T337A possibly damaging Het
Atrn A G 2: 131,023,027 E1358G probably damaging Het
Caml C A 13: 55,623,249 S53R possibly damaging Het
Cd180 T G 13: 102,705,633 S396A probably benign Het
Cdhr2 A G 13: 54,718,512 T344A probably damaging Het
Cyp4a31 A C 4: 115,570,269 D224A probably damaging Het
Dhx36 T C 3: 62,484,974 T544A probably damaging Het
Dnah14 A G 1: 181,651,657 K1528E probably damaging Het
Dnpep T A 1: 75,315,378 K199N probably benign Het
Dsc2 C T 18: 20,051,175 probably null Het
Efl1 T A 7: 82,674,568 D239E probably damaging Het
Elovl4 A G 9: 83,785,178 V42A possibly damaging Het
Exoc3 T C 13: 74,189,187 T432A possibly damaging Het
Fam98c A G 7: 29,156,128 probably null Het
Fbln2 G A 6: 91,233,272 G66D probably damaging Het
Fchsd1 G A 18: 37,964,084 T410I possibly damaging Het
Flcn T C 11: 59,801,082 D247G probably damaging Het
Galnt16 T C 12: 80,575,903 V127A probably benign Het
H2-Ob A T 17: 34,243,886 probably null Het
Has2 G A 15: 56,667,798 S507F possibly damaging Het
Ido2 T A 8: 24,533,923 M300L probably damaging Het
Itga10 T C 3: 96,658,041 probably null Het
Klra9 G T 6: 130,179,032 Y253* probably null Het
Mfsd2a A G 4: 122,950,457 V299A probably benign Het
Mybpc1 T C 10: 88,560,355 D210G probably damaging Het
Ndrg1 A T 15: 66,933,872 M128K probably damaging Het
Obscn T A 11: 59,051,558 T5091S probably benign Het
Olfr137 A G 17: 38,305,413 L16P probably damaging Het
Pex5 A T 6: 124,413,613 M91K possibly damaging Het
Phlpp2 G T 8: 109,934,685 A810S probably benign Het
Pla2g7 G C 17: 43,599,126 A174P probably damaging Het
Plxna4 C T 6: 32,215,678 V783M probably damaging Het
Poll A T 19: 45,553,604 M421K probably benign Het
Ppfia2 C A 10: 106,913,698 S1148R possibly damaging Het
Prkg1 A G 19: 30,781,346 F280S probably benign Het
Rdh10 G A 1: 16,107,855 C117Y probably damaging Het
Rtl1 C A 12: 109,595,196 A70S unknown Het
Scgb2b3 A T 7: 31,359,067 L104I probably benign Het
Sh3tc1 T C 5: 35,706,597 R749G probably damaging Het
Skint4 A G 4: 112,146,510 K380R probably benign Het
Smtnl1 A C 2: 84,818,368 S181A probably benign Het
Spata31d1b T C 13: 59,717,185 S716P probably damaging Het
Stab2 C T 10: 86,901,567 probably null Het
Timm22 T C 11: 76,409,744 V114A possibly damaging Het
Timp4 A G 6: 115,247,220 C163R probably damaging Het
Toporsl T A 4: 52,611,548 N480K possibly damaging Het
Tpo T C 12: 30,084,754 E735G probably benign Het
Trpm3 A G 19: 22,901,305 D692G probably damaging Het
Ttn T C 2: 76,751,714 H22945R probably damaging Het
Vmn2r6 A T 3: 64,547,380 Y499* probably null Het
Vwa1 G A 4: 155,772,769 H191Y probably benign Het
Other mutations in Spc25
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01757:Spc25 APN 2 69202608 nonsense probably null
IGL02273:Spc25 APN 2 69204929 splice site probably benign
IGL03163:Spc25 APN 2 69197204 missense probably damaging 1.00
R1519:Spc25 UTSW 2 69200087 missense probably damaging 1.00
R1604:Spc25 UTSW 2 69205154 missense probably damaging 0.99
R2913:Spc25 UTSW 2 69199987 missense probably benign 0.42
R3973:Spc25 UTSW 2 69202601 missense probably damaging 1.00
R4094:Spc25 UTSW 2 69202631 missense probably damaging 1.00
R4444:Spc25 UTSW 2 69204876 missense probably benign 0.06
R5293:Spc25 UTSW 2 69202652 missense possibly damaging 0.92
R6242:Spc25 UTSW 2 69197211 missense probably damaging 1.00
R6721:Spc25 UTSW 2 69197173 missense possibly damaging 0.96
R7712:Spc25 UTSW 2 69206137 missense unknown
R7866:Spc25 UTSW 2 69206062 critical splice donor site probably null
R8054:Spc25 UTSW 2 69204913 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTTTTCTGCATCAGACCCCTG -3'
(R):5'- ACCAATCCTTGCACGGAGAG -3'

Sequencing Primer
(F):5'- GGAGTGTGATCGGGACCG -3'
(R):5'- AATCCTTGCACGGAGAGTCTGC -3'
Posted On2018-05-24