Mutagenetix > Incidental Mutation

Incidental Mutation 'R6433:Smtnl1'

518623

Institutional Source

Beutler Lab

Gene Symbol

Smtnl1

Ensembl Gene

ENSMUSG00000027077

Gene Name

smoothelin-like 1

Synonyms

Chasm, 1110030K22Rik

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6433 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

84811176-84822652 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 84818368 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Alanine at position 181 (S181A)

Ref Sequence

ENSEMBL: ENSMUSP00000028471 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028471]

AlphaFold

Q99LM3

PDB Structure

The Solution Structure of Calponin Homology Domain from Smoothelin-like 1 [SOLUTION NMR]
HADDOCK-derived structure of the CH-domain of the smoothelin-like 1 complexed with the C-domain of apocalmodulin [SOLUTION NMR]

Predicted Effect

probably benign
Transcript: ENSMUST00000028471
AA Change: S181A

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000028471
Gene: ENSMUSG00000027077
AA Change: S181A

Domain	Start	End	E-Value	Type
low complexity region	56	72	N/A	INTRINSIC
coiled coil region	124	154	N/A	INTRINSIC
low complexity region	218	230	N/A	INTRINSIC
low complexity region	236	246	N/A	INTRINSIC
low complexity region	260	285	N/A	INTRINSIC
CH	345	444	5.55e-18	SMART

Meta Mutation Damage Score

0.0672

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 97.9%
20x: 93.6%

Validation Efficiency

100% (56/56)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is involved in the contraction of both striated and smooth muscle. During pregnancy, the encoded protein interacts with progesterone receptor to attenuate the expression of contractile and metabolic proteins. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for a null allele exhibit vascular and muscular adaptations normally found in exercised animals as well as increased exercise endurance. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Afdn	T	A	17: 13,881,299	D1016E	probably damaging	Het
Aplnr	A	T	2: 85,136,673	Q14L	probably benign	Het
Aspm	T	C	1: 139,473,683	L1147S	probably damaging	Het
Atad2b	A	G	12: 4,952,642	T337A	possibly damaging	Het
Atrn	A	G	2: 131,023,027	E1358G	probably damaging	Het
Caml	C	A	13: 55,623,249	S53R	possibly damaging	Het
Cd180	T	G	13: 102,705,633	S396A	probably benign	Het
Cdhr2	A	G	13: 54,718,512	T344A	probably damaging	Het
Cyp4a31	A	C	4: 115,570,269	D224A	probably damaging	Het
Dhx36	T	C	3: 62,484,974	T544A	probably damaging	Het
Dnah14	A	G	1: 181,651,657	K1528E	probably damaging	Het
Dnpep	T	A	1: 75,315,378	K199N	probably benign	Het
Dsc2	C	T	18: 20,051,175		probably null	Het
Efl1	T	A	7: 82,674,568	D239E	probably damaging	Het
Elovl4	A	G	9: 83,785,178	V42A	possibly damaging	Het
Exoc3	T	C	13: 74,189,187	T432A	possibly damaging	Het
Fam98c	A	G	7: 29,156,128		probably null	Het
Fbln2	G	A	6: 91,233,272	G66D	probably damaging	Het
Fchsd1	G	A	18: 37,964,084	T410I	possibly damaging	Het
Flcn	T	C	11: 59,801,082	D247G	probably damaging	Het
Galnt16	T	C	12: 80,575,903	V127A	probably benign	Het
H2-Ob	A	T	17: 34,243,886		probably null	Het
Has2	G	A	15: 56,667,798	S507F	possibly damaging	Het
Ido2	T	A	8: 24,533,923	M300L	probably damaging	Het
Itga10	T	C	3: 96,658,041		probably null	Het
Klra9	G	T	6: 130,179,032	Y253*	probably null	Het
Mfsd2a	A	G	4: 122,950,457	V299A	probably benign	Het
Mybpc1	T	C	10: 88,560,355	D210G	probably damaging	Het
Ndrg1	A	T	15: 66,933,872	M128K	probably damaging	Het
Obscn	T	A	11: 59,051,558	T5091S	probably benign	Het
Olfr137	A	G	17: 38,305,413	L16P	probably damaging	Het
Pex5	A	T	6: 124,413,613	M91K	possibly damaging	Het
Phlpp2	G	T	8: 109,934,685	A810S	probably benign	Het
Pla2g7	G	C	17: 43,599,126	A174P	probably damaging	Het
Plxna4	C	T	6: 32,215,678	V783M	probably damaging	Het
Poll	A	T	19: 45,553,604	M421K	probably benign	Het
Ppfia2	C	A	10: 106,913,698	S1148R	possibly damaging	Het
Prkg1	A	G	19: 30,781,346	F280S	probably benign	Het
Rdh10	G	A	1: 16,107,855	C117Y	probably damaging	Het
Rtl1	C	A	12: 109,595,196	A70S	unknown	Het
Scgb2b3	A	T	7: 31,359,067	L104I	probably benign	Het
Sh3tc1	T	C	5: 35,706,597	R749G	probably damaging	Het
Skint4	A	G	4: 112,146,510	K380R	probably benign	Het
Spata31d1b	T	C	13: 59,717,185	S716P	probably damaging	Het
Spc25	A	G	2: 69,206,102		probably benign	Het
Stab2	C	T	10: 86,901,567		probably null	Het
Timm22	T	C	11: 76,409,744	V114A	possibly damaging	Het
Timp4	A	G	6: 115,247,220	C163R	probably damaging	Het
Toporsl	T	A	4: 52,611,548	N480K	possibly damaging	Het
Tpo	T	C	12: 30,084,754	E735G	probably benign	Het
Trpm3	A	G	19: 22,901,305	D692G	probably damaging	Het
Ttn	T	C	2: 76,751,714	H22945R	probably damaging	Het
Vmn2r6	A	T	3: 64,547,380	Y499*	probably null	Het
Vwa1	G	A	4: 155,772,769	H191Y	probably benign	Het

Other mutations in Smtnl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01135:Smtnl1	APN	2	84818887	missense	probably benign
IGL01702:Smtnl1	APN	2	84818690	missense	possibly damaging	0.71
IGL01836:Smtnl1	APN	2	84815370	missense	probably damaging	1.00
IGL01866:Smtnl1	APN	2	84818745	missense	possibly damaging	0.80
IGL01869:Smtnl1	APN	2	84811397	makesense	probably null
IGL01989:Smtnl1	APN	2	84818470	missense	probably benign	0.22
IGL02247:Smtnl1	APN	2	84817028	splice site	probably benign
R1442:Smtnl1	UTSW	2	84818436	missense	probably damaging	0.97
R4577:Smtnl1	UTSW	2	84818443	missense	possibly damaging	0.50
R5340:Smtnl1	UTSW	2	84815441	missense	probably damaging	1.00
R5524:Smtnl1	UTSW	2	84818894	missense	probably benign	0.05
R5561:Smtnl1	UTSW	2	84818395	missense	probably benign	0.31
R5631:Smtnl1	UTSW	2	84818754	missense	probably benign
R5997:Smtnl1	UTSW	2	84815378	missense	probably damaging	1.00
R6050:Smtnl1	UTSW	2	84811453	missense	probably damaging	1.00
R7011:Smtnl1	UTSW	2	84818409	missense	probably benign	0.01
R8390:Smtnl1	UTSW	2	84815350	nonsense	probably null
R8406:Smtnl1	UTSW	2	84818398	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- TGTGTGTCCCTGTGTCAATACA -3'
(R):5'- CTGAACCCAATGAAGTTAGGGAGAAA -3'

Sequencing Primer
(F):5'- GGACTGAAACCTTTGAAACCATGGTC -3'
(R):5'- AGAGGAGGCCATGCTGG -3'

Posted On

2018-05-24