Incidental Mutation 'R6433:Aplnr'
ID518624
Institutional Source Beutler Lab
Gene Symbol Aplnr
Ensembl Gene ENSMUSG00000044338
Gene Nameapelin receptor
Synonymsapelin receptor, APJ, Agtrl1, msr/apj
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6433 (G1)
Quality Score181.009
Status Validated
Chromosome2
Chromosomal Location85136225-85139923 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 85136673 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 14 (Q14L)
Ref Sequence ENSEMBL: ENSMUSP00000053638 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057019] [ENSMUST00000184728]
Predicted Effect probably benign
Transcript: ENSMUST00000057019
AA Change: Q14L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000053638
Gene: ENSMUSG00000044338
AA Change: Q14L

DomainStartEndE-ValueType
Pfam:TAS2R 25 326 1.1e-8 PFAM
Pfam:7tm_1 43 307 4e-61 PFAM
Pfam:7TM_GPCR_Srv 46 324 3.5e-8 PFAM
low complexity region 335 349 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000184728
SMART Domains Protein: ENSMUSP00000139142
Gene: ENSMUSG00000044338

DomainStartEndE-ValueType
SCOP:d1l9ha_ 1 47 7e-3 SMART
Meta Mutation Damage Score 0.0607 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.6%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the G protein-coupled receptor gene family. The encoded protein is related to the angiotensin receptor, but is actually an apelin receptor that inhibits adenylate cyclase activity and plays a counter-regulatory role against the pressure action of angiotensin II by exerting hypertensive effect. It functions in the cardiovascular and central nervous systems, in glucose metabolism, in embryonic and tumor angiogenesis and as a human immunodeficiency virus (HIV-1) coreceptor. Two transcript variants resulting from alternative splicing have been identified. [provided by RefSeq, Jul 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit early lethality, decreased cardiac contractility, and decreased exercise endurance. Mice for another knock-out allele develop pulmonary venoocclusive disease with heart right ventricle hypertrophy and elevated pulmonary pressures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afdn T A 17: 13,881,299 D1016E probably damaging Het
Aspm T C 1: 139,473,683 L1147S probably damaging Het
Atad2b A G 12: 4,952,642 T337A possibly damaging Het
Atrn A G 2: 131,023,027 E1358G probably damaging Het
Caml C A 13: 55,623,249 S53R possibly damaging Het
Cd180 T G 13: 102,705,633 S396A probably benign Het
Cdhr2 A G 13: 54,718,512 T344A probably damaging Het
Cyp4a31 A C 4: 115,570,269 D224A probably damaging Het
Dhx36 T C 3: 62,484,974 T544A probably damaging Het
Dnah14 A G 1: 181,651,657 K1528E probably damaging Het
Dnpep T A 1: 75,315,378 K199N probably benign Het
Dsc2 C T 18: 20,051,175 probably null Het
Efl1 T A 7: 82,674,568 D239E probably damaging Het
Elovl4 A G 9: 83,785,178 V42A possibly damaging Het
Exoc3 T C 13: 74,189,187 T432A possibly damaging Het
Fam98c A G 7: 29,156,128 probably null Het
Fbln2 G A 6: 91,233,272 G66D probably damaging Het
Fchsd1 G A 18: 37,964,084 T410I possibly damaging Het
Flcn T C 11: 59,801,082 D247G probably damaging Het
Galnt16 T C 12: 80,575,903 V127A probably benign Het
H2-Ob A T 17: 34,243,886 probably null Het
Has2 G A 15: 56,667,798 S507F possibly damaging Het
Ido2 T A 8: 24,533,923 M300L probably damaging Het
Itga10 T C 3: 96,658,041 probably null Het
Klra9 G T 6: 130,179,032 Y253* probably null Het
Mfsd2a A G 4: 122,950,457 V299A probably benign Het
Mybpc1 T C 10: 88,560,355 D210G probably damaging Het
Ndrg1 A T 15: 66,933,872 M128K probably damaging Het
Obscn T A 11: 59,051,558 T5091S probably benign Het
Olfr137 A G 17: 38,305,413 L16P probably damaging Het
Pex5 A T 6: 124,413,613 M91K possibly damaging Het
Phlpp2 G T 8: 109,934,685 A810S probably benign Het
Pla2g7 G C 17: 43,599,126 A174P probably damaging Het
Plxna4 C T 6: 32,215,678 V783M probably damaging Het
Poll A T 19: 45,553,604 M421K probably benign Het
Ppfia2 C A 10: 106,913,698 S1148R possibly damaging Het
Prkg1 A G 19: 30,781,346 F280S probably benign Het
Rdh10 G A 1: 16,107,855 C117Y probably damaging Het
Rtl1 C A 12: 109,595,196 A70S unknown Het
Scgb2b3 A T 7: 31,359,067 L104I probably benign Het
Sh3tc1 T C 5: 35,706,597 R749G probably damaging Het
Skint4 A G 4: 112,146,510 K380R probably benign Het
Smtnl1 A C 2: 84,818,368 S181A probably benign Het
Spata31d1b T C 13: 59,717,185 S716P probably damaging Het
Spc25 A G 2: 69,206,102 probably benign Het
Stab2 C T 10: 86,901,567 probably null Het
Timm22 T C 11: 76,409,744 V114A possibly damaging Het
Timp4 A G 6: 115,247,220 C163R probably damaging Het
Toporsl T A 4: 52,611,548 N480K possibly damaging Het
Tpo T C 12: 30,084,754 E735G probably benign Het
Trpm3 A G 19: 22,901,305 D692G probably damaging Het
Ttn T C 2: 76,751,714 H22945R probably damaging Het
Vmn2r6 A T 3: 64,547,380 Y499* probably null Het
Vwa1 G A 4: 155,772,769 H191Y probably benign Het
Other mutations in Aplnr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Aplnr APN 2 85137641 missense probably benign 0.00
IGL00985:Aplnr APN 2 85137663 missense probably benign 0.02
PIT4810001:Aplnr UTSW 2 85137284 missense probably damaging 1.00
R0009:Aplnr UTSW 2 85137276 unclassified probably null
R0009:Aplnr UTSW 2 85137276 unclassified probably null
R0201:Aplnr UTSW 2 85137177 missense probably damaging 1.00
R1268:Aplnr UTSW 2 85137431 missense possibly damaging 0.80
R1386:Aplnr UTSW 2 85137461 missense possibly damaging 0.71
R1445:Aplnr UTSW 2 85137009 missense probably damaging 1.00
R1663:Aplnr UTSW 2 85136694 missense possibly damaging 0.53
R1967:Aplnr UTSW 2 85137606 missense probably benign
R4119:Aplnr UTSW 2 85136966 missense possibly damaging 0.96
R4672:Aplnr UTSW 2 85137180 missense probably damaging 1.00
R4916:Aplnr UTSW 2 85136917 missense probably damaging 1.00
R4968:Aplnr UTSW 2 85136945 missense probably damaging 1.00
R4990:Aplnr UTSW 2 85137377 missense probably damaging 0.96
R5067:Aplnr UTSW 2 85136784 missense probably damaging 1.00
R6235:Aplnr UTSW 2 85137626 missense probably benign
R6828:Aplnr UTSW 2 85139759 utr 3 prime probably benign
R6898:Aplnr UTSW 2 85139811 utr 3 prime probably benign
R7547:Aplnr UTSW 2 85137177 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAAGGACTCTAAGCACCCTCAG -3'
(R):5'- GGTAGGTATAAGTGGCCCAC -3'

Sequencing Primer
(F):5'- TAAGCACCCTCAGACCTCTTACTC -3'
(R):5'- TATAAGTGGCCCACAGTGGC -3'
Posted On2018-05-24