Mutagenetix > Incidental Mutations

Incidental Mutation 'R6433:Atrn'

518625

Institutional Source

Beutler Lab

Gene Symbol

Atrn

Ensembl Gene

ENSMUSG00000027312

Gene Name

attractin

Synonyms

Mgca

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6433 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

130906495-131030333 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 131023027 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 1358 (E1358G)

Ref Sequence

ENSEMBL: ENSMUSP00000028781 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028781]

Predicted Effect

probably damaging
Transcript: ENSMUST00000028781
AA Change: E1358G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000028781
Gene: ENSMUSG00000027312
AA Change: E1358G

Domain	Start	End	E-Value	Type
low complexity region	2	9	N/A	INTRINSIC
low complexity region	51	97	N/A	INTRINSIC
EGF	99	129	9.85e-5	SMART
CUB	131	247	7.85e-18	SMART
EGF	248	282	1.47e1	SMART
Pfam:Kelch_1	339	382	1.1e-7	PFAM
Pfam:Kelch_5	389	434	2.5e-7	PFAM
Pfam:Kelch_6	390	439	3.3e-8	PFAM
Pfam:Kelch_1	553	606	8.4e-8	PFAM
PSI	646	693	7.41e-7	SMART
PSI	702	747	8.64e-8	SMART
PSI	754	799	2.11e-2	SMART
CLECT	787	918	6.14e-20	SMART
PSI	931	982	1.11e-5	SMART
PSI	985	1060	1.2e-6	SMART
EGF_Lam	1062	1105	1.97e-4	SMART
EGF_like	1108	1154	3.9e0	SMART
transmembrane domain	1278	1300	N/A	INTRINSIC
low complexity region	1310	1322	N/A	INTRINSIC
low complexity region	1373	1385	N/A	INTRINSIC

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 97.9%
20x: 93.6%

Validation Efficiency

100% (56/56)

MGI Phenotype

FUNCTION: This gene encodes a widely expressed transmembrane glycoprotein that plays important roles in diverse physiological processes such as regulation of hair pigmentation, monocyte-T cell interaction and control of energy homeostasis. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional protein. Certain mutations in this gene are responsible for the mahogany mouse phenotype of dark brown or black coat on a normally agouti background. Mice with loss-of-function mutations in this gene exhibit black coat color, tremor, adiposity, higher basal metabolic rate, juvenile-onset hypomyelination and age-dependent spongiform neurodegeneration of the central nervous system. [provided by RefSeq, Jul 2016]
PHENOTYPE: Some mutant homozygotes exhibit decreases in phaeomelanin synthesis, body weight, and adiposity; increases in locomotion, and abnormal myelination and vacuolation of the central nervous system resulting in tremors. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Afdn	T	A	17: 13,881,299	D1016E	probably damaging	Het
Aplnr	A	T	2: 85,136,673	Q14L	probably benign	Het
Aspm	T	C	1: 139,473,683	L1147S	probably damaging	Het
Atad2b	A	G	12: 4,952,642	T337A	possibly damaging	Het
Caml	C	A	13: 55,623,249	S53R	possibly damaging	Het
Cd180	T	G	13: 102,705,633	S396A	probably benign	Het
Cdhr2	A	G	13: 54,718,512	T344A	probably damaging	Het
Cyp4a31	A	C	4: 115,570,269	D224A	probably damaging	Het
Dhx36	T	C	3: 62,484,974	T544A	probably damaging	Het
Dnah14	A	G	1: 181,651,657	K1528E	probably damaging	Het
Dnpep	T	A	1: 75,315,378	K199N	probably benign	Het
Dsc2	C	T	18: 20,051,175		probably null	Het
Efl1	T	A	7: 82,674,568	D239E	probably damaging	Het
Elovl4	A	G	9: 83,785,178	V42A	possibly damaging	Het
Exoc3	T	C	13: 74,189,187	T432A	possibly damaging	Het
Fam98c	A	G	7: 29,156,128		probably null	Het
Fbln2	G	A	6: 91,233,272	G66D	probably damaging	Het
Fchsd1	G	A	18: 37,964,084	T410I	possibly damaging	Het
Flcn	T	C	11: 59,801,082	D247G	probably damaging	Het
Galnt16	T	C	12: 80,575,903	V127A	probably benign	Het
H2-Ob	A	T	17: 34,243,886		probably null	Het
Has2	G	A	15: 56,667,798	S507F	possibly damaging	Het
Ido2	T	A	8: 24,533,923	M300L	probably damaging	Het
Itga10	T	C	3: 96,658,041		probably null	Het
Klra9	G	T	6: 130,179,032	Y253*	probably null	Het
Mfsd2a	A	G	4: 122,950,457	V299A	probably benign	Het
Mybpc1	T	C	10: 88,560,355	D210G	probably damaging	Het
Ndrg1	A	T	15: 66,933,872	M128K	probably damaging	Het
Obscn	T	A	11: 59,051,558	T5091S	probably benign	Het
Olfr137	A	G	17: 38,305,413	L16P	probably damaging	Het
Pex5	A	T	6: 124,413,613	M91K	possibly damaging	Het
Phlpp2	G	T	8: 109,934,685	A810S	probably benign	Het
Pla2g7	G	C	17: 43,599,126	A174P	probably damaging	Het
Plxna4	C	T	6: 32,215,678	V783M	probably damaging	Het
Poll	A	T	19: 45,553,604	M421K	probably benign	Het
Ppfia2	C	A	10: 106,913,698	S1148R	possibly damaging	Het
Prkg1	A	G	19: 30,781,346	F280S	probably benign	Het
Rdh10	G	A	1: 16,107,855	C117Y	probably damaging	Het
Rtl1	C	A	12: 109,595,196	A70S	unknown	Het
Scgb2b3	A	T	7: 31,359,067	L104I	probably benign	Het
Sh3tc1	T	C	5: 35,706,597	R749G	probably damaging	Het
Skint4	A	G	4: 112,146,510	K380R	probably benign	Het
Smtnl1	A	C	2: 84,818,368	S181A	probably benign	Het
Spata31d1b	T	C	13: 59,717,185	S716P	probably damaging	Het
Spc25	A	G	2: 69,206,102		probably benign	Het
Stab2	C	T	10: 86,901,567		probably null	Het
Timm22	T	C	11: 76,409,744	V114A	possibly damaging	Het
Timp4	A	G	6: 115,247,220	C163R	probably damaging	Het
Toporsl	T	A	4: 52,611,548	N480K	possibly damaging	Het
Tpo	T	C	12: 30,084,754	E735G	probably benign	Het
Trpm3	A	G	19: 22,901,305	D692G	probably damaging	Het
Ttn	T	C	2: 76,751,714	H22945R	probably damaging	Het
Vmn2r6	A	T	3: 64,547,380	Y499*	probably null	Het
Vwa1	G	A	4: 155,772,769	H191Y	probably benign	Het

Other mutations in Atrn

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00337:Atrn	APN	2	130958079	missense	probably damaging	1.00
IGL00571:Atrn	APN	2	130995048	missense	probably damaging	1.00
IGL01092:Atrn	APN	2	130947636	nonsense	probably null
IGL01572:Atrn	APN	2	131002795	missense	probably damaging	1.00
IGL01924:Atrn	APN	2	130935565	missense	probably damaging	1.00
IGL02116:Atrn	APN	2	130958089	missense	probably damaging	1.00
IGL02372:Atrn	APN	2	131002754	splice site	probably benign
IGL02390:Atrn	APN	2	131020977	missense	possibly damaging	0.82
IGL02548:Atrn	APN	2	130972282	missense	probably damaging	1.00
IGL02749:Atrn	APN	2	130970144	nonsense	probably null
IGL02749:Atrn	APN	2	130947734	splice site	probably benign
BB010:Atrn	UTSW	2	130995066	missense	probably damaging	1.00
BB020:Atrn	UTSW	2	130995066	missense	probably damaging	1.00
R0026:Atrn	UTSW	2	130957920	missense	probably damaging	1.00
R0403:Atrn	UTSW	2	130906859	missense	probably damaging	1.00
R0479:Atrn	UTSW	2	130999165	nonsense	probably null
R0544:Atrn	UTSW	2	130986826	missense	probably damaging	1.00
R0570:Atrn	UTSW	2	130980134	missense	probably benign	0.01
R0606:Atrn	UTSW	2	130906856	missense	possibly damaging	0.90
R0617:Atrn	UTSW	2	130995085	critical splice donor site	probably null
R0658:Atrn	UTSW	2	130970227	critical splice donor site	probably null
R1108:Atrn	UTSW	2	130957914	missense	probably damaging	1.00
R1112:Atrn	UTSW	2	130999161	missense	probably benign	0.04
R1219:Atrn	UTSW	2	131021007	missense	possibly damaging	0.90
R1422:Atrn	UTSW	2	130957914	missense	probably damaging	1.00
R1524:Atrn	UTSW	2	130957080	missense	probably benign	0.15
R1653:Atrn	UTSW	2	130935624	missense	probably benign
R1795:Atrn	UTSW	2	130972288	missense	probably benign
R1807:Atrn	UTSW	2	130982772	missense	possibly damaging	0.94
R1920:Atrn	UTSW	2	130995051	missense	probably damaging	1.00
R1921:Atrn	UTSW	2	130995051	missense	probably damaging	1.00
R1935:Atrn	UTSW	2	130958035	missense	probably damaging	1.00
R1982:Atrn	UTSW	2	130970222	missense	probably benign
R2000:Atrn	UTSW	2	130935588	missense	probably damaging	1.00
R2143:Atrn	UTSW	2	130957996	missense	probably benign	0.03
R2336:Atrn	UTSW	2	130957954	missense	probably damaging	1.00
R2679:Atrn	UTSW	2	130961675	critical splice donor site	probably null
R3426:Atrn	UTSW	2	131020956	missense	probably benign	0.06
R3909:Atrn	UTSW	2	130994207	missense	probably damaging	1.00
R4077:Atrn	UTSW	2	130964930	critical splice donor site	probably null
R4162:Atrn	UTSW	2	130994228	splice site	probably benign
R4195:Atrn	UTSW	2	130933412	missense	probably damaging	1.00
R4364:Atrn	UTSW	2	130970208	missense	probably benign	0.39
R4465:Atrn	UTSW	2	130960468	missense	probably benign	0.08
R4510:Atrn	UTSW	2	130935577	nonsense	probably null
R4511:Atrn	UTSW	2	130935577	nonsense	probably null
R4527:Atrn	UTSW	2	130973504	missense	probably benign	0.10
R4586:Atrn	UTSW	2	130982042	missense	probably damaging	1.00
R4592:Atrn	UTSW	2	130999130	intron	probably benign
R4658:Atrn	UTSW	2	130933429	missense	probably damaging	1.00
R4735:Atrn	UTSW	2	131020990	missense	probably benign	0.06
R4960:Atrn	UTSW	2	130995047	nonsense	probably null
R4999:Atrn	UTSW	2	130975954	missense	probably damaging	1.00
R5066:Atrn	UTSW	2	130994193	missense	possibly damaging	0.60
R5080:Atrn	UTSW	2	130970124	missense	possibly damaging	0.95
R5141:Atrn	UTSW	2	130999130	intron	probably benign
R5256:Atrn	UTSW	2	130946019	missense	probably benign	0.39
R5494:Atrn	UTSW	2	131023075	missense	probably damaging	1.00
R5678:Atrn	UTSW	2	130970016	missense	probably damaging	0.96
R5752:Atrn	UTSW	2	130906544	unclassified	probably benign
R5931:Atrn	UTSW	2	130933436	missense	possibly damaging	0.56
R6023:Atrn	UTSW	2	131020980	missense	probably benign	0.25
R6176:Atrn	UTSW	2	130946091	missense	probably benign	0.31
R6377:Atrn	UTSW	2	130979969	missense	probably damaging	1.00
R7226:Atrn	UTSW	2	130986744	missense	probably damaging	0.99
R7402:Atrn	UTSW	2	130947600	missense	probably damaging	1.00
R7541:Atrn	UTSW	2	130961571	missense	possibly damaging	0.46
R7587:Atrn	UTSW	2	130980114	missense	probably damaging	1.00
R7872:Atrn	UTSW	2	130970227	critical splice donor site	probably null
R7910:Atrn	UTSW	2	130964887	missense	probably benign	0.04
R7913:Atrn	UTSW	2	130970211	missense	probably damaging	1.00
R7933:Atrn	UTSW	2	130995066	missense	probably damaging	1.00
R7955:Atrn	UTSW	2	130970227	critical splice donor site	probably null
R7991:Atrn	UTSW	2	130964887	missense	probably benign	0.04
R7994:Atrn	UTSW	2	130970211	missense	probably damaging	1.00
R8044:Atrn	UTSW	2	130935529	missense	probably damaging	1.00
R8079:Atrn	UTSW	2	131013641	missense	probably null	1.00
R8093:Atrn	UTSW	2	130975988	missense	probably benign	0.00
R8203:Atrn	UTSW	2	130960549	missense	probably benign	0.00
R8234:Atrn	UTSW	2	131023000	critical splice acceptor site	probably null
RF009:Atrn	UTSW	2	130906922	missense	probably benign	0.12
X0024:Atrn	UTSW	2	130958139	missense	probably damaging	1.00
Z1088:Atrn	UTSW	2	130973399	missense	probably benign
Z1176:Atrn	UTSW	2	130946193	missense	probably benign	0.27
Z1177:Atrn	UTSW	2	130946042	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- TGTGCAACAGGTCACCATAC -3'
(R):5'- TGGGGACTATAGAATTGTTCCACC -3'

Sequencing Primer
(F):5'- ATACAAACCGGCGTGGGC -3'
(R):5'- AGCTCTGTACCACTAAGCACTGTG -3'

Posted On

2018-05-24