Incidental Mutation 'R6433:Dhx36'
ID518626
Institutional Source Beutler Lab
Gene Symbol Dhx36
Ensembl Gene ENSMUSG00000027770
Gene NameDEAH (Asp-Glu-Ala-His) box polypeptide 36
Synonyms2810407E23Rik, Ddx36
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6433 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location62468013-62507004 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 62484974 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 544 (T544A)
Ref Sequence ENSEMBL: ENSMUSP00000029336 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029336]
Predicted Effect probably damaging
Transcript: ENSMUST00000029336
AA Change: T544A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000029336
Gene: ENSMUSG00000027770
AA Change: T544A

DomainStartEndE-ValueType
low complexity region 10 45 N/A INTRINSIC
DEXDc 198 389 1.53e-31 SMART
HELICc 495 600 5.61e-16 SMART
HA2 662 753 2.23e-26 SMART
Pfam:OB_NTP_bind 792 910 1.2e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162070
Meta Mutation Damage Score 0.9715 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.6%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the DEAH-box family of RNA-dependent NTPases which are named after the conserved amino acid sequence Asp-Glu-Ala-His in motif II. The protein encoded by this gene has been shown to enhance the deadenylation and decay of mRNAs with 3'-UTR AU-rich elements (ARE-mRNA). The protein has also been shown to resolve into single strands the highly stable tetramolecular DNA configuration (G4) that can form spontaneously in guanine-rich regions of DNA. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit lethality around E7.0. Mice homozygous for a conditional allele activated in the hematopoiesis systemexhibit impaired erythropoiesis associated with cell cycle defect. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afdn T A 17: 13,881,299 D1016E probably damaging Het
Aplnr A T 2: 85,136,673 Q14L probably benign Het
Aspm T C 1: 139,473,683 L1147S probably damaging Het
Atad2b A G 12: 4,952,642 T337A possibly damaging Het
Atrn A G 2: 131,023,027 E1358G probably damaging Het
Caml C A 13: 55,623,249 S53R possibly damaging Het
Cd180 T G 13: 102,705,633 S396A probably benign Het
Cdhr2 A G 13: 54,718,512 T344A probably damaging Het
Cyp4a31 A C 4: 115,570,269 D224A probably damaging Het
Dnah14 A G 1: 181,651,657 K1528E probably damaging Het
Dnpep T A 1: 75,315,378 K199N probably benign Het
Dsc2 C T 18: 20,051,175 probably null Het
Efl1 T A 7: 82,674,568 D239E probably damaging Het
Elovl4 A G 9: 83,785,178 V42A possibly damaging Het
Exoc3 T C 13: 74,189,187 T432A possibly damaging Het
Fam98c A G 7: 29,156,128 probably null Het
Fbln2 G A 6: 91,233,272 G66D probably damaging Het
Fchsd1 G A 18: 37,964,084 T410I possibly damaging Het
Flcn T C 11: 59,801,082 D247G probably damaging Het
Galnt16 T C 12: 80,575,903 V127A probably benign Het
H2-Ob A T 17: 34,243,886 probably null Het
Has2 G A 15: 56,667,798 S507F possibly damaging Het
Ido2 T A 8: 24,533,923 M300L probably damaging Het
Itga10 T C 3: 96,658,041 probably null Het
Klra9 G T 6: 130,179,032 Y253* probably null Het
Mfsd2a A G 4: 122,950,457 V299A probably benign Het
Mybpc1 T C 10: 88,560,355 D210G probably damaging Het
Ndrg1 A T 15: 66,933,872 M128K probably damaging Het
Obscn T A 11: 59,051,558 T5091S probably benign Het
Olfr137 A G 17: 38,305,413 L16P probably damaging Het
Pex5 A T 6: 124,413,613 M91K possibly damaging Het
Phlpp2 G T 8: 109,934,685 A810S probably benign Het
Pla2g7 G C 17: 43,599,126 A174P probably damaging Het
Plxna4 C T 6: 32,215,678 V783M probably damaging Het
Poll A T 19: 45,553,604 M421K probably benign Het
Ppfia2 C A 10: 106,913,698 S1148R possibly damaging Het
Prkg1 A G 19: 30,781,346 F280S probably benign Het
Rdh10 G A 1: 16,107,855 C117Y probably damaging Het
Rtl1 C A 12: 109,595,196 A70S unknown Het
Scgb2b3 A T 7: 31,359,067 L104I probably benign Het
Sh3tc1 T C 5: 35,706,597 R749G probably damaging Het
Skint4 A G 4: 112,146,510 K380R probably benign Het
Smtnl1 A C 2: 84,818,368 S181A probably benign Het
Spata31d1b T C 13: 59,717,185 S716P probably damaging Het
Spc25 A G 2: 69,206,102 probably benign Het
Stab2 C T 10: 86,901,567 probably null Het
Timm22 T C 11: 76,409,744 V114A possibly damaging Het
Timp4 A G 6: 115,247,220 C163R probably damaging Het
Toporsl T A 4: 52,611,548 N480K possibly damaging Het
Tpo T C 12: 30,084,754 E735G probably benign Het
Trpm3 A G 19: 22,901,305 D692G probably damaging Het
Ttn T C 2: 76,751,714 H22945R probably damaging Het
Vmn2r6 A T 3: 64,547,380 Y499* probably null Het
Vwa1 G A 4: 155,772,769 H191Y probably benign Het
Other mutations in Dhx36
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00495:Dhx36 APN 3 62470558 utr 3 prime probably benign
IGL00538:Dhx36 APN 3 62501045 missense probably benign 0.04
IGL00706:Dhx36 APN 3 62496842 missense probably damaging 1.00
IGL02040:Dhx36 APN 3 62501015 missense probably benign
IGL02141:Dhx36 APN 3 62493889 missense probably benign 0.25
IGL02514:Dhx36 APN 3 62500898 missense possibly damaging 0.63
IGL02540:Dhx36 APN 3 62506888 missense probably benign 0.07
IGL02629:Dhx36 APN 3 62506734 missense probably benign 0.01
IGL02858:Dhx36 APN 3 62477376 splice site probably benign
IGL03305:Dhx36 APN 3 62500836 nonsense probably null
R0002:Dhx36 UTSW 3 62480839 missense probably damaging 1.00
R0002:Dhx36 UTSW 3 62480839 missense probably damaging 1.00
R0021:Dhx36 UTSW 3 62477595 missense possibly damaging 0.66
R0021:Dhx36 UTSW 3 62477595 missense possibly damaging 0.66
R0671:Dhx36 UTSW 3 62493741 missense possibly damaging 0.96
R0735:Dhx36 UTSW 3 62472729 missense probably benign 0.00
R0782:Dhx36 UTSW 3 62506714 splice site probably benign
R1725:Dhx36 UTSW 3 62506939 start codon destroyed probably benign 0.01
R1951:Dhx36 UTSW 3 62484273 missense probably damaging 0.99
R1959:Dhx36 UTSW 3 62479385 missense probably benign 0.01
R2257:Dhx36 UTSW 3 62477643 missense probably damaging 1.00
R2397:Dhx36 UTSW 3 62498097 missense probably benign 0.00
R2484:Dhx36 UTSW 3 62472815 missense probably damaging 0.96
R2973:Dhx36 UTSW 3 62495495 missense probably benign 0.00
R2973:Dhx36 UTSW 3 62495498 missense possibly damaging 0.56
R3617:Dhx36 UTSW 3 62472007 missense possibly damaging 0.96
R3617:Dhx36 UTSW 3 62487060 missense probably benign 0.01
R3725:Dhx36 UTSW 3 62488222 splice site probably benign
R3898:Dhx36 UTSW 3 62492369 missense probably damaging 0.98
R4332:Dhx36 UTSW 3 62484991 missense probably damaging 1.00
R4359:Dhx36 UTSW 3 62475278 missense probably benign 0.05
R4493:Dhx36 UTSW 3 62488504 intron probably benign
R4652:Dhx36 UTSW 3 62500998 missense probably benign 0.01
R4866:Dhx36 UTSW 3 62472777 missense probably damaging 1.00
R4884:Dhx36 UTSW 3 62484260 missense probably damaging 1.00
R4960:Dhx36 UTSW 3 62496859 missense probably damaging 1.00
R5083:Dhx36 UTSW 3 62471999 missense probably benign 0.17
R5162:Dhx36 UTSW 3 62493780 missense probably damaging 1.00
R5815:Dhx36 UTSW 3 62493755 missense probably damaging 1.00
R6090:Dhx36 UTSW 3 62496820 missense probably damaging 0.98
R6392:Dhx36 UTSW 3 62494369 missense probably benign 0.00
R6504:Dhx36 UTSW 3 62488639 missense probably benign
R6615:Dhx36 UTSW 3 62488917 missense probably benign
R6672:Dhx36 UTSW 3 62495536 missense probably damaging 1.00
R6672:Dhx36 UTSW 3 62500879 missense probably benign 0.00
R7172:Dhx36 UTSW 3 62501015 missense probably benign
R7302:Dhx36 UTSW 3 62479393 missense probably benign
R7487:Dhx36 UTSW 3 62484202 missense possibly damaging 0.91
R7515:Dhx36 UTSW 3 62472087 missense probably benign 0.45
R7531:Dhx36 UTSW 3 62484968 missense probably damaging 1.00
R7579:Dhx36 UTSW 3 62480873 missense possibly damaging 0.64
R7726:Dhx36 UTSW 3 62488968 missense probably benign 0.01
R7874:Dhx36 UTSW 3 62488631 missense probably benign
R8056:Dhx36 UTSW 3 62488591 missense possibly damaging 0.93
R8226:Dhx36 UTSW 3 62470570 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ATAGCGCTATATCAGTTCCCATG -3'
(R):5'- ATGATAGACCAGTGCACAAGATAC -3'

Sequencing Primer
(F):5'- CAGTTCCCATGATTCTTTAGAGAAG -3'
(R):5'- ATGCTAAAATGATCACTATCTC -3'
Posted On2018-05-24