Incidental Mutation 'R6433:Vwa1'
ID518633
Institutional Source Beutler Lab
Gene Symbol Vwa1
Ensembl Gene ENSMUSG00000042116
Gene Namevon Willebrand factor A domain containing 1
Synonyms4932416A11Rik, WARP
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6433 (G1)
Quality Score181.009
Status Validated
Chromosome4
Chromosomal Location155768149-155774698 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 155772769 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Tyrosine at position 191 (H191Y)
Ref Sequence ENSEMBL: ENSMUSP00000040405 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042196]
Predicted Effect probably benign
Transcript: ENSMUST00000042196
AA Change: H191Y

PolyPhen 2 Score 0.070 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000040405
Gene: ENSMUSG00000042116
AA Change: H191Y

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
VWA 32 210 3.05e-36 SMART
FN3 212 292 1.95e0 SMART
FN3 305 385 1.4e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174185
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180784
Meta Mutation Damage Score 0.0926 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.6%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] VWA1 belongs to the von Willebrand factor (VWF; MIM 613160) A (VWFA) domain superfamily of extracellular matrix proteins and appears to play a role in cartilage structure and function (Fitzgerald et al., 2002 [PubMed 12062410]).[supplied by OMIM, Nov 2010]
PHENOTYPE: Mice homozygous for a reporter allele exhibit abnormal motor coordination/balance, increased thermal nociceptive threshold, and altered peripheral nerve structure and function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afdn T A 17: 13,881,299 D1016E probably damaging Het
Aplnr A T 2: 85,136,673 Q14L probably benign Het
Aspm T C 1: 139,473,683 L1147S probably damaging Het
Atad2b A G 12: 4,952,642 T337A possibly damaging Het
Atrn A G 2: 131,023,027 E1358G probably damaging Het
Caml C A 13: 55,623,249 S53R possibly damaging Het
Cd180 T G 13: 102,705,633 S396A probably benign Het
Cdhr2 A G 13: 54,718,512 T344A probably damaging Het
Cyp4a31 A C 4: 115,570,269 D224A probably damaging Het
Dhx36 T C 3: 62,484,974 T544A probably damaging Het
Dnah14 A G 1: 181,651,657 K1528E probably damaging Het
Dnpep T A 1: 75,315,378 K199N probably benign Het
Dsc2 C T 18: 20,051,175 probably null Het
Efl1 T A 7: 82,674,568 D239E probably damaging Het
Elovl4 A G 9: 83,785,178 V42A possibly damaging Het
Exoc3 T C 13: 74,189,187 T432A possibly damaging Het
Fam98c A G 7: 29,156,128 probably null Het
Fbln2 G A 6: 91,233,272 G66D probably damaging Het
Fchsd1 G A 18: 37,964,084 T410I possibly damaging Het
Flcn T C 11: 59,801,082 D247G probably damaging Het
Galnt16 T C 12: 80,575,903 V127A probably benign Het
H2-Ob A T 17: 34,243,886 probably null Het
Has2 G A 15: 56,667,798 S507F possibly damaging Het
Ido2 T A 8: 24,533,923 M300L probably damaging Het
Itga10 T C 3: 96,658,041 probably null Het
Klra9 G T 6: 130,179,032 Y253* probably null Het
Mfsd2a A G 4: 122,950,457 V299A probably benign Het
Mybpc1 T C 10: 88,560,355 D210G probably damaging Het
Ndrg1 A T 15: 66,933,872 M128K probably damaging Het
Obscn T A 11: 59,051,558 T5091S probably benign Het
Olfr137 A G 17: 38,305,413 L16P probably damaging Het
Pex5 A T 6: 124,413,613 M91K possibly damaging Het
Phlpp2 G T 8: 109,934,685 A810S probably benign Het
Pla2g7 G C 17: 43,599,126 A174P probably damaging Het
Plxna4 C T 6: 32,215,678 V783M probably damaging Het
Poll A T 19: 45,553,604 M421K probably benign Het
Ppfia2 C A 10: 106,913,698 S1148R possibly damaging Het
Prkg1 A G 19: 30,781,346 F280S probably benign Het
Rdh10 G A 1: 16,107,855 C117Y probably damaging Het
Rtl1 C A 12: 109,595,196 A70S unknown Het
Scgb2b3 A T 7: 31,359,067 L104I probably benign Het
Sh3tc1 T C 5: 35,706,597 R749G probably damaging Het
Skint4 A G 4: 112,146,510 K380R probably benign Het
Smtnl1 A C 2: 84,818,368 S181A probably benign Het
Spata31d1b T C 13: 59,717,185 S716P probably damaging Het
Spc25 A G 2: 69,206,102 probably benign Het
Stab2 C T 10: 86,901,567 probably null Het
Timm22 T C 11: 76,409,744 V114A possibly damaging Het
Timp4 A G 6: 115,247,220 C163R probably damaging Het
Toporsl T A 4: 52,611,548 N480K possibly damaging Het
Tpo T C 12: 30,084,754 E735G probably benign Het
Trpm3 A G 19: 22,901,305 D692G probably damaging Het
Ttn T C 2: 76,751,714 H22945R probably damaging Het
Vmn2r6 A T 3: 64,547,380 Y499* probably null Het
Other mutations in Vwa1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01364:Vwa1 APN 4 155770743 critical splice donor site probably null
IGL01611:Vwa1 APN 4 155770798 missense possibly damaging 0.64
R1174:Vwa1 UTSW 4 155773266 missense probably damaging 0.96
R1433:Vwa1 UTSW 4 155772901 missense probably damaging 0.99
R1953:Vwa1 UTSW 4 155773114 missense probably damaging 1.00
R2006:Vwa1 UTSW 4 155770850 missense probably benign
R2105:Vwa1 UTSW 4 155772793 missense probably damaging 1.00
R2346:Vwa1 UTSW 4 155773069 missense probably benign 0.00
R3891:Vwa1 UTSW 4 155773194 missense probably damaging 1.00
R4919:Vwa1 UTSW 4 155770600 missense probably benign 0.10
R5285:Vwa1 UTSW 4 155770895 missense probably benign 0.38
R5320:Vwa1 UTSW 4 155770912 missense probably benign 0.00
R5554:Vwa1 UTSW 4 155773238 missense probably damaging 1.00
R5666:Vwa1 UTSW 4 155774465 missense probably damaging 1.00
R5670:Vwa1 UTSW 4 155774465 missense probably damaging 1.00
R8135:Vwa1 UTSW 4 155772894 missense probably damaging 1.00
R8400:Vwa1 UTSW 4 155772768 missense probably benign 0.03
R8784:Vwa1 UTSW 4 155772888 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TACGTGCCTGGATGGTATGC -3'
(R):5'- GCCAAAGAACAATTGTTTGCTG -3'

Sequencing Primer
(F):5'- GGTGGGCCACTATCACATACTC -3'
(R):5'- GAACAATTGTTTGCTGAGGAAGC -3'
Posted On2018-05-24