Incidental Mutation 'R6433:Sh3tc1'
ID518634
Institutional Source Beutler Lab
Gene Symbol Sh3tc1
Ensembl Gene ENSMUSG00000036553
Gene NameSH3 domain and tetratricopeptide repeats 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.096) question?
Stock #R6433 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location35697180-35739987 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 35706597 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 749 (R749G)
Ref Sequence ENSEMBL: ENSMUSP00000144175 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070203] [ENSMUST00000129664] [ENSMUST00000201511]
Predicted Effect probably damaging
Transcript: ENSMUST00000070203
AA Change: R749G

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000070610
Gene: ENSMUSG00000036553
AA Change: R749G

DomainStartEndE-ValueType
low complexity region 6 15 N/A INTRINSIC
low complexity region 101 117 N/A INTRINSIC
low complexity region 270 278 N/A INTRINSIC
SH3 312 371 1.72e-6 SMART
low complexity region 381 397 N/A INTRINSIC
low complexity region 422 434 N/A INTRINSIC
low complexity region 541 552 N/A INTRINSIC
TPR 565 598 3.41e1 SMART
Blast:TPR 607 639 2e-6 BLAST
TPR 668 701 3.37e-2 SMART
TPR 796 829 6.4e1 SMART
Blast:TPR 874 902 2e-6 BLAST
TPR 913 946 9.99e1 SMART
TPR 1202 1235 4.31e0 SMART
low complexity region 1266 1277 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127288
Predicted Effect unknown
Transcript: ENSMUST00000127825
AA Change: R687G
SMART Domains Protein: ENSMUSP00000115376
Gene: ENSMUSG00000036553
AA Change: R687G

DomainStartEndE-ValueType
low complexity region 40 56 N/A INTRINSIC
low complexity region 209 217 N/A INTRINSIC
SH3 251 310 1.72e-6 SMART
low complexity region 320 336 N/A INTRINSIC
low complexity region 361 373 N/A INTRINSIC
low complexity region 480 491 N/A INTRINSIC
TPR 504 537 3.41e1 SMART
Blast:TPR 546 578 2e-6 BLAST
TPR 607 640 3.37e-2 SMART
TPR 735 768 6.4e1 SMART
Blast:TPR 813 841 2e-6 BLAST
TPR 852 885 9.99e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000129664
SMART Domains Protein: ENSMUSP00000119811
Gene: ENSMUSG00000036553

DomainStartEndE-ValueType
low complexity region 34 42 N/A INTRINSIC
SH3 76 130 2.41e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151555
Predicted Effect probably damaging
Transcript: ENSMUST00000201511
AA Change: R749G

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000144175
Gene: ENSMUSG00000036553
AA Change: R749G

DomainStartEndE-ValueType
low complexity region 6 15 N/A INTRINSIC
low complexity region 101 117 N/A INTRINSIC
low complexity region 270 278 N/A INTRINSIC
SH3 312 371 1.72e-6 SMART
low complexity region 381 397 N/A INTRINSIC
low complexity region 422 434 N/A INTRINSIC
low complexity region 541 552 N/A INTRINSIC
TPR 565 598 3.41e1 SMART
Blast:TPR 607 639 2e-6 BLAST
TPR 668 701 3.37e-2 SMART
TPR 796 829 6.4e1 SMART
Blast:TPR 874 902 2e-6 BLAST
TPR 913 946 9.99e1 SMART
TPR 1202 1235 4.31e0 SMART
low complexity region 1266 1277 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.6%
Validation Efficiency 100% (56/56)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afdn T A 17: 13,881,299 D1016E probably damaging Het
Aplnr A T 2: 85,136,673 Q14L probably benign Het
Aspm T C 1: 139,473,683 L1147S probably damaging Het
Atad2b A G 12: 4,952,642 T337A possibly damaging Het
Atrn A G 2: 131,023,027 E1358G probably damaging Het
Caml C A 13: 55,623,249 S53R possibly damaging Het
Cd180 T G 13: 102,705,633 S396A probably benign Het
Cdhr2 A G 13: 54,718,512 T344A probably damaging Het
Cyp4a31 A C 4: 115,570,269 D224A probably damaging Het
Dhx36 T C 3: 62,484,974 T544A probably damaging Het
Dnah14 A G 1: 181,651,657 K1528E probably damaging Het
Dnpep T A 1: 75,315,378 K199N probably benign Het
Dsc2 C T 18: 20,051,175 probably null Het
Efl1 T A 7: 82,674,568 D239E probably damaging Het
Elovl4 A G 9: 83,785,178 V42A possibly damaging Het
Exoc3 T C 13: 74,189,187 T432A possibly damaging Het
Fam98c A G 7: 29,156,128 probably null Het
Fbln2 G A 6: 91,233,272 G66D probably damaging Het
Fchsd1 G A 18: 37,964,084 T410I possibly damaging Het
Flcn T C 11: 59,801,082 D247G probably damaging Het
Galnt16 T C 12: 80,575,903 V127A probably benign Het
H2-Ob A T 17: 34,243,886 probably null Het
Has2 G A 15: 56,667,798 S507F possibly damaging Het
Ido2 T A 8: 24,533,923 M300L probably damaging Het
Itga10 T C 3: 96,658,041 probably null Het
Klra9 G T 6: 130,179,032 Y253* probably null Het
Mfsd2a A G 4: 122,950,457 V299A probably benign Het
Mybpc1 T C 10: 88,560,355 D210G probably damaging Het
Ndrg1 A T 15: 66,933,872 M128K probably damaging Het
Obscn T A 11: 59,051,558 T5091S probably benign Het
Olfr137 A G 17: 38,305,413 L16P probably damaging Het
Pex5 A T 6: 124,413,613 M91K possibly damaging Het
Phlpp2 G T 8: 109,934,685 A810S probably benign Het
Pla2g7 G C 17: 43,599,126 A174P probably damaging Het
Plxna4 C T 6: 32,215,678 V783M probably damaging Het
Poll A T 19: 45,553,604 M421K probably benign Het
Ppfia2 C A 10: 106,913,698 S1148R possibly damaging Het
Prkg1 A G 19: 30,781,346 F280S probably benign Het
Rdh10 G A 1: 16,107,855 C117Y probably damaging Het
Rtl1 C A 12: 109,595,196 A70S unknown Het
Scgb2b3 A T 7: 31,359,067 L104I probably benign Het
Skint4 A G 4: 112,146,510 K380R probably benign Het
Smtnl1 A C 2: 84,818,368 S181A probably benign Het
Spata31d1b T C 13: 59,717,185 S716P probably damaging Het
Spc25 A G 2: 69,206,102 probably benign Het
Stab2 C T 10: 86,901,567 probably null Het
Timm22 T C 11: 76,409,744 V114A possibly damaging Het
Timp4 A G 6: 115,247,220 C163R probably damaging Het
Toporsl T A 4: 52,611,548 N480K possibly damaging Het
Tpo T C 12: 30,084,754 E735G probably benign Het
Trpm3 A G 19: 22,901,305 D692G probably damaging Het
Ttn T C 2: 76,751,714 H22945R probably damaging Het
Vmn2r6 A T 3: 64,547,380 Y499* probably null Het
Vwa1 G A 4: 155,772,769 H191Y probably benign Het
Other mutations in Sh3tc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00234:Sh3tc1 APN 5 35710957 missense probably damaging 1.00
IGL01019:Sh3tc1 APN 5 35703375 missense probably damaging 1.00
IGL01725:Sh3tc1 APN 5 35700316 missense probably benign 0.08
IGL02069:Sh3tc1 APN 5 35718995 missense probably benign 0.45
IGL02153:Sh3tc1 APN 5 35703352 missense probably damaging 1.00
IGL02269:Sh3tc1 APN 5 35706284 missense probably benign 0.21
IGL02609:Sh3tc1 APN 5 35707172 missense probably damaging 0.99
IGL02984:Sh3tc1 UTSW 5 35714059 splice site probably null
R0280:Sh3tc1 UTSW 5 35706017 missense probably damaging 1.00
R0305:Sh3tc1 UTSW 5 35723999 missense probably benign
R0322:Sh3tc1 UTSW 5 35706561 missense possibly damaging 0.86
R0485:Sh3tc1 UTSW 5 35702012 splice site probably benign
R0511:Sh3tc1 UTSW 5 35703462 missense probably damaging 1.00
R0513:Sh3tc1 UTSW 5 35700307 missense possibly damaging 0.87
R0523:Sh3tc1 UTSW 5 35724066 small deletion probably benign
R0550:Sh3tc1 UTSW 5 35699784 missense probably damaging 0.99
R0676:Sh3tc1 UTSW 5 35719114 splice site probably benign
R1485:Sh3tc1 UTSW 5 35719026 missense probably benign 0.00
R1559:Sh3tc1 UTSW 5 35703349 critical splice donor site probably null
R1599:Sh3tc1 UTSW 5 35707512 missense probably benign 0.05
R1759:Sh3tc1 UTSW 5 35705904 missense possibly damaging 0.95
R1808:Sh3tc1 UTSW 5 35705924 missense probably benign 0.01
R1816:Sh3tc1 UTSW 5 35700584 critical splice donor site probably null
R2036:Sh3tc1 UTSW 5 35716164 missense probably benign 0.01
R2092:Sh3tc1 UTSW 5 35700658 missense probably damaging 1.00
R2944:Sh3tc1 UTSW 5 35714160 missense probably damaging 1.00
R4258:Sh3tc1 UTSW 5 35706978 missense probably benign 0.00
R4556:Sh3tc1 UTSW 5 35707082 missense probably damaging 1.00
R4647:Sh3tc1 UTSW 5 35706318 missense probably damaging 1.00
R5011:Sh3tc1 UTSW 5 35700289 missense probably damaging 1.00
R5740:Sh3tc1 UTSW 5 35707055 missense probably benign 0.00
R6023:Sh3tc1 UTSW 5 35706951 nonsense probably null
R6164:Sh3tc1 UTSW 5 35706246 missense probably benign 0.05
R6262:Sh3tc1 UTSW 5 35699773 missense probably damaging 1.00
R6932:Sh3tc1 UTSW 5 35707434 missense probably benign 0.01
R6986:Sh3tc1 UTSW 5 35723944 missense probably benign
R7098:Sh3tc1 UTSW 5 35702014 splice site probably null
R7502:Sh3tc1 UTSW 5 35706062 missense probably damaging 0.96
R7737:Sh3tc1 UTSW 5 35723953 missense probably benign 0.15
R7792:Sh3tc1 UTSW 5 35710951 missense probably damaging 0.97
R8079:Sh3tc1 UTSW 5 35706857 missense possibly damaging 0.78
R8154:Sh3tc1 UTSW 5 35718352 missense probably damaging 1.00
X0061:Sh3tc1 UTSW 5 35706809 missense probably damaging 1.00
Z1176:Sh3tc1 UTSW 5 35714229 missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- TGCAGCCTGAGACATGAAGG -3'
(R):5'- TACCTGGAGAGACTGCTTCG -3'

Sequencing Primer
(F):5'- AATGGCCTGGCTGTACTGC -3'
(R):5'- GAGAGACTGCTTCGCCTCAAC -3'
Posted On2018-05-24