Incidental Mutation 'R6433:Fbln2'
ID518637
Institutional Source Beutler Lab
Gene Symbol Fbln2
Ensembl Gene ENSMUSG00000064080
Gene Namefibulin 2
Synonyms5730577E14Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6433 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location91212455-91272540 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 91233272 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 66 (G66D)
Ref Sequence ENSEMBL: ENSMUSP00000116302 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041544] [ENSMUST00000113498] [ENSMUST00000132021] [ENSMUST00000134974] [ENSMUST00000153364]
Predicted Effect probably damaging
Transcript: ENSMUST00000041544
AA Change: G66D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000048334
Gene: ENSMUSG00000064080
AA Change: G66D

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Blast:VWC 72 138 8e-35 BLAST
low complexity region 201 215 N/A INTRINSIC
low complexity region 217 233 N/A INTRINSIC
low complexity region 242 262 N/A INTRINSIC
low complexity region 267 289 N/A INTRINSIC
low complexity region 313 320 N/A INTRINSIC
ANATO 435 470 1.54e-11 SMART
ANATO 478 509 4.67e-2 SMART
ANATO 511 543 2.78e-9 SMART
low complexity region 546 569 N/A INTRINSIC
EGF_CA 594 635 3.1e-11 SMART
EGF 672 708 1.88e-1 SMART
EGF 712 755 1.33e1 SMART
EGF_CA 756 800 1.34e-6 SMART
EGF_CA 801 846 1.65e-6 SMART
EGF_CA 847 894 2.06e-7 SMART
EGF_CA 895 937 3.56e-11 SMART
EGF_CA 938 979 3.48e-14 SMART
EGF_CA 980 1018 1.7e-8 SMART
EGF_CA 1019 1061 8.18e-11 SMART
EGF_CA 1062 1106 5.08e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000113498
AA Change: G66D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109126
Gene: ENSMUSG00000064080
AA Change: G66D

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Blast:VWC 72 138 8e-35 BLAST
low complexity region 201 215 N/A INTRINSIC
low complexity region 217 233 N/A INTRINSIC
low complexity region 242 262 N/A INTRINSIC
low complexity region 267 289 N/A INTRINSIC
low complexity region 313 320 N/A INTRINSIC
ANATO 435 470 1.54e-11 SMART
ANATO 478 509 4.67e-2 SMART
ANATO 511 543 2.78e-9 SMART
low complexity region 546 569 N/A INTRINSIC
EGF_CA 594 635 3.1e-11 SMART
EGF 672 708 1.88e-1 SMART
EGF_CA 709 753 1.34e-6 SMART
EGF_CA 754 799 1.65e-6 SMART
EGF_CA 800 847 2.06e-7 SMART
EGF_CA 848 890 3.56e-11 SMART
EGF_CA 891 932 3.48e-14 SMART
EGF_CA 933 971 1.7e-8 SMART
EGF_CA 972 1014 8.18e-11 SMART
EGF_CA 1015 1059 5.08e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000132021
AA Change: G66D

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000116456
Gene: ENSMUSG00000064080
AA Change: G66D

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000134974
AA Change: G66D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000116302
Gene: ENSMUSG00000064080
AA Change: G66D

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000153364
Meta Mutation Damage Score 0.5846 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.6%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an extracellular matrix protein, which belongs to the fibulin family. This protein binds various extracellular ligands and calcium. It may play a role during organ development, in particular, during the differentiation of heart, skeletal and neuronal structures. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out alle are viable, fertile and grossly normal with no apparent defects in elastic fiber formation in the aorta and skin. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afdn T A 17: 13,881,299 D1016E probably damaging Het
Aplnr A T 2: 85,136,673 Q14L probably benign Het
Aspm T C 1: 139,473,683 L1147S probably damaging Het
Atad2b A G 12: 4,952,642 T337A possibly damaging Het
Atrn A G 2: 131,023,027 E1358G probably damaging Het
Caml C A 13: 55,623,249 S53R possibly damaging Het
Cd180 T G 13: 102,705,633 S396A probably benign Het
Cdhr2 A G 13: 54,718,512 T344A probably damaging Het
Cyp4a31 A C 4: 115,570,269 D224A probably damaging Het
Dhx36 T C 3: 62,484,974 T544A probably damaging Het
Dnah14 A G 1: 181,651,657 K1528E probably damaging Het
Dnpep T A 1: 75,315,378 K199N probably benign Het
Dsc2 C T 18: 20,051,175 probably null Het
Efl1 T A 7: 82,674,568 D239E probably damaging Het
Elovl4 A G 9: 83,785,178 V42A possibly damaging Het
Exoc3 T C 13: 74,189,187 T432A possibly damaging Het
Fam98c A G 7: 29,156,128 probably null Het
Fchsd1 G A 18: 37,964,084 T410I possibly damaging Het
Flcn T C 11: 59,801,082 D247G probably damaging Het
Galnt16 T C 12: 80,575,903 V127A probably benign Het
H2-Ob A T 17: 34,243,886 probably null Het
Has2 G A 15: 56,667,798 S507F possibly damaging Het
Ido2 T A 8: 24,533,923 M300L probably damaging Het
Itga10 T C 3: 96,658,041 probably null Het
Klra9 G T 6: 130,179,032 Y253* probably null Het
Mfsd2a A G 4: 122,950,457 V299A probably benign Het
Mybpc1 T C 10: 88,560,355 D210G probably damaging Het
Ndrg1 A T 15: 66,933,872 M128K probably damaging Het
Obscn T A 11: 59,051,558 T5091S probably benign Het
Olfr137 A G 17: 38,305,413 L16P probably damaging Het
Pex5 A T 6: 124,413,613 M91K possibly damaging Het
Phlpp2 G T 8: 109,934,685 A810S probably benign Het
Pla2g7 G C 17: 43,599,126 A174P probably damaging Het
Plxna4 C T 6: 32,215,678 V783M probably damaging Het
Poll A T 19: 45,553,604 M421K probably benign Het
Ppfia2 C A 10: 106,913,698 S1148R possibly damaging Het
Prkg1 A G 19: 30,781,346 F280S probably benign Het
Rdh10 G A 1: 16,107,855 C117Y probably damaging Het
Rtl1 C A 12: 109,595,196 A70S unknown Het
Scgb2b3 A T 7: 31,359,067 L104I probably benign Het
Sh3tc1 T C 5: 35,706,597 R749G probably damaging Het
Skint4 A G 4: 112,146,510 K380R probably benign Het
Smtnl1 A C 2: 84,818,368 S181A probably benign Het
Spata31d1b T C 13: 59,717,185 S716P probably damaging Het
Spc25 A G 2: 69,206,102 probably benign Het
Stab2 C T 10: 86,901,567 probably null Het
Timm22 T C 11: 76,409,744 V114A possibly damaging Het
Timp4 A G 6: 115,247,220 C163R probably damaging Het
Toporsl T A 4: 52,611,548 N480K possibly damaging Het
Tpo T C 12: 30,084,754 E735G probably benign Het
Trpm3 A G 19: 22,901,305 D692G probably damaging Het
Ttn T C 2: 76,751,714 H22945R probably damaging Het
Vmn2r6 A T 3: 64,547,380 Y499* probably null Het
Vwa1 G A 4: 155,772,769 H191Y probably benign Het
Other mutations in Fbln2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01406:Fbln2 APN 6 91266392 missense probably damaging 1.00
IGL01664:Fbln2 APN 6 91233457 missense probably damaging 0.96
IGL02110:Fbln2 APN 6 91234102 missense probably benign 0.01
IGL02227:Fbln2 APN 6 91256367 missense possibly damaging 0.90
IGL02814:Fbln2 APN 6 91265857 nonsense probably null
IGL03287:Fbln2 APN 6 91233494 missense probably damaging 1.00
IGL03412:Fbln2 APN 6 91271781 missense probably damaging 1.00
IGL03014:Fbln2 UTSW 6 91265919 intron probably benign
R0103:Fbln2 UTSW 6 91271550 missense probably benign
R0103:Fbln2 UTSW 6 91271550 missense probably benign
R1563:Fbln2 UTSW 6 91263383 nonsense probably null
R1843:Fbln2 UTSW 6 91265775 missense probably damaging 1.00
R1846:Fbln2 UTSW 6 91256417 missense possibly damaging 0.91
R1994:Fbln2 UTSW 6 91234301 missense probably damaging 1.00
R2431:Fbln2 UTSW 6 91269973 missense probably damaging 0.98
R2443:Fbln2 UTSW 6 91259711 missense probably damaging 1.00
R2925:Fbln2 UTSW 6 91265855 missense probably damaging 1.00
R3030:Fbln2 UTSW 6 91233715 missense probably damaging 1.00
R3758:Fbln2 UTSW 6 91256381 missense probably damaging 1.00
R3854:Fbln2 UTSW 6 91266371 missense probably damaging 1.00
R4006:Fbln2 UTSW 6 91269961 splice site probably null
R4627:Fbln2 UTSW 6 91259767 missense probably damaging 1.00
R4752:Fbln2 UTSW 6 91256243 missense probably benign
R4763:Fbln2 UTSW 6 91270000 missense probably damaging 1.00
R4798:Fbln2 UTSW 6 91269186 missense probably benign 0.03
R4877:Fbln2 UTSW 6 91233495 missense probably damaging 1.00
R4878:Fbln2 UTSW 6 91256995 critical splice donor site probably null
R4937:Fbln2 UTSW 6 91264699 missense probably damaging 0.99
R4969:Fbln2 UTSW 6 91271587 missense possibly damaging 0.64
R4996:Fbln2 UTSW 6 91266010 missense probably benign 0.05
R5344:Fbln2 UTSW 6 91266383 missense probably damaging 1.00
R5681:Fbln2 UTSW 6 91271796 missense probably damaging 1.00
R5838:Fbln2 UTSW 6 91271848 missense possibly damaging 0.55
R6035:Fbln2 UTSW 6 91263353 missense probably damaging 1.00
R6035:Fbln2 UTSW 6 91263353 missense probably damaging 1.00
R6288:Fbln2 UTSW 6 91233281 missense probably damaging 1.00
R6451:Fbln2 UTSW 6 91234259 missense probably benign 0.18
R6491:Fbln2 UTSW 6 91259750 missense possibly damaging 0.68
R6520:Fbln2 UTSW 6 91259659 missense probably damaging 1.00
R6657:Fbln2 UTSW 6 91259750 missense possibly damaging 0.68
R6987:Fbln2 UTSW 6 91234229 missense probably benign 0.00
R7344:Fbln2 UTSW 6 91269973 missense probably damaging 0.98
R7485:Fbln2 UTSW 6 91270161 splice site probably null
R7488:Fbln2 UTSW 6 91265863 critical splice donor site probably null
R7571:Fbln2 UTSW 6 91268575 missense probably damaging 1.00
R7667:Fbln2 UTSW 6 91233667 missense probably damaging 1.00
R7776:Fbln2 UTSW 6 91269199 missense probably damaging 1.00
R7779:Fbln2 UTSW 6 91233194 missense probably damaging 1.00
R8320:Fbln2 UTSW 6 91257767 missense possibly damaging 0.51
R8487:Fbln2 UTSW 6 91250864 missense probably damaging 0.97
Z1088:Fbln2 UTSW 6 91233346 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCTAGGGACTCCTGAGACATG -3'
(R):5'- CTGTCGGCTACTACTACAGC -3'

Sequencing Primer
(F):5'- TGAGACATGCTGCTCCAGGAATC -3'
(R):5'- CTACTACAGCTTCAATGCAGTTGGG -3'
Posted On2018-05-24