Incidental Mutation 'R6433:Timp4'
ID518638
Institutional Source Beutler Lab
Gene Symbol Timp4
Ensembl Gene ENSMUSG00000030317
Gene Nametissue inhibitor of metalloproteinase 4
SynonymsTIMP-4
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.175) question?
Stock #R6433 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location115241892-115252205 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 115247220 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 163 (C163R)
Ref Sequence ENSEMBL: ENSMUSP00000144785 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000009538] [ENSMUST00000032462] [ENSMUST00000166681] [ENSMUST00000169345] [ENSMUST00000203450] [ENSMUST00000205131]
Predicted Effect probably benign
Transcript: ENSMUST00000009538
SMART Domains Protein: ENSMUSP00000009538
Gene: ENSMUSG00000009394

DomainStartEndE-ValueType
Pfam:Synapsin_N 2 33 3.4e-24 PFAM
Pfam:Synapsin 112 213 6.4e-48 PFAM
Pfam:Synapsin_C 215 417 8.2e-140 PFAM
low complexity region 450 470 N/A INTRINSIC
low complexity region 473 507 N/A INTRINSIC
low complexity region 524 540 N/A INTRINSIC
low complexity region 551 562 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000032462
SMART Domains Protein: ENSMUSP00000032462
Gene: ENSMUSG00000030317

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
NTR 30 207 1.85e-122 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000166681
Predicted Effect probably benign
Transcript: ENSMUST00000169345
SMART Domains Protein: ENSMUSP00000133121
Gene: ENSMUSG00000009394

DomainStartEndE-ValueType
Pfam:Synapsin_N 2 33 1.3e-24 PFAM
Pfam:Synapsin 109 213 1.6e-62 PFAM
Pfam:Synapsin_C 215 417 4.4e-133 PFAM
Pfam:RimK 247 403 4.5e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000203450
SMART Domains Protein: ENSMUSP00000144921
Gene: ENSMUSG00000009394

DomainStartEndE-ValueType
Pfam:Synapsin_N 2 33 2.7e-24 PFAM
Pfam:Synapsin 112 213 4.6e-48 PFAM
Pfam:Synapsin_C 215 417 5.3e-140 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203707
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203768
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204617
Predicted Effect probably damaging
Transcript: ENSMUST00000205131
AA Change: C163R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000144785
Gene: ENSMUSG00000030317
AA Change: C163R

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
NTR 30 175 2.6e-76 SMART
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.6%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the TIMP gene family. The proteins encoded by this gene family are inhibitors of the matrix metalloproteinases, a group of peptidases involved in degradation of the extracellular matrix. The secreted, netrin domain-containing protein encoded by this gene is involved in regulation of platelet aggregation and recruitment and may play role in hormonal regulation and endometrial tissue remodeling. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele show increased lethality associated with left ventricle rupture following left anterior descending coronary artery ligation. Aged mice exhibit reduced myocardial performance index, decreased coronary flow rate, and increased left ventricle thickness and weight. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afdn T A 17: 13,881,299 D1016E probably damaging Het
Aplnr A T 2: 85,136,673 Q14L probably benign Het
Aspm T C 1: 139,473,683 L1147S probably damaging Het
Atad2b A G 12: 4,952,642 T337A possibly damaging Het
Atrn A G 2: 131,023,027 E1358G probably damaging Het
Caml C A 13: 55,623,249 S53R possibly damaging Het
Cd180 T G 13: 102,705,633 S396A probably benign Het
Cdhr2 A G 13: 54,718,512 T344A probably damaging Het
Cyp4a31 A C 4: 115,570,269 D224A probably damaging Het
Dhx36 T C 3: 62,484,974 T544A probably damaging Het
Dnah14 A G 1: 181,651,657 K1528E probably damaging Het
Dnpep T A 1: 75,315,378 K199N probably benign Het
Dsc2 C T 18: 20,051,175 probably null Het
Efl1 T A 7: 82,674,568 D239E probably damaging Het
Elovl4 A G 9: 83,785,178 V42A possibly damaging Het
Exoc3 T C 13: 74,189,187 T432A possibly damaging Het
Fam98c A G 7: 29,156,128 probably null Het
Fbln2 G A 6: 91,233,272 G66D probably damaging Het
Fchsd1 G A 18: 37,964,084 T410I possibly damaging Het
Flcn T C 11: 59,801,082 D247G probably damaging Het
Galnt16 T C 12: 80,575,903 V127A probably benign Het
H2-Ob A T 17: 34,243,886 probably null Het
Has2 G A 15: 56,667,798 S507F possibly damaging Het
Ido2 T A 8: 24,533,923 M300L probably damaging Het
Itga10 T C 3: 96,658,041 probably null Het
Klra9 G T 6: 130,179,032 Y253* probably null Het
Mfsd2a A G 4: 122,950,457 V299A probably benign Het
Mybpc1 T C 10: 88,560,355 D210G probably damaging Het
Ndrg1 A T 15: 66,933,872 M128K probably damaging Het
Obscn T A 11: 59,051,558 T5091S probably benign Het
Olfr137 A G 17: 38,305,413 L16P probably damaging Het
Pex5 A T 6: 124,413,613 M91K possibly damaging Het
Phlpp2 G T 8: 109,934,685 A810S probably benign Het
Pla2g7 G C 17: 43,599,126 A174P probably damaging Het
Plxna4 C T 6: 32,215,678 V783M probably damaging Het
Poll A T 19: 45,553,604 M421K probably benign Het
Ppfia2 C A 10: 106,913,698 S1148R possibly damaging Het
Prkg1 A G 19: 30,781,346 F280S probably benign Het
Rdh10 G A 1: 16,107,855 C117Y probably damaging Het
Rtl1 C A 12: 109,595,196 A70S unknown Het
Scgb2b3 A T 7: 31,359,067 L104I probably benign Het
Sh3tc1 T C 5: 35,706,597 R749G probably damaging Het
Skint4 A G 4: 112,146,510 K380R probably benign Het
Smtnl1 A C 2: 84,818,368 S181A probably benign Het
Spata31d1b T C 13: 59,717,185 S716P probably damaging Het
Spc25 A G 2: 69,206,102 probably benign Het
Stab2 C T 10: 86,901,567 probably null Het
Timm22 T C 11: 76,409,744 V114A possibly damaging Het
Toporsl T A 4: 52,611,548 N480K possibly damaging Het
Tpo T C 12: 30,084,754 E735G probably benign Het
Trpm3 A G 19: 22,901,305 D692G probably damaging Het
Ttn T C 2: 76,751,714 H22945R probably damaging Het
Vmn2r6 A T 3: 64,547,380 Y499* probably null Het
Vwa1 G A 4: 155,772,769 H191Y probably benign Het
Other mutations in Timp4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01302:Timp4 APN 6 115246308 missense possibly damaging 0.73
IGL02267:Timp4 APN 6 115247279 missense possibly damaging 0.70
IGL02368:Timp4 APN 6 115246399 intron probably null
IGL02501:Timp4 APN 6 115246483 missense probably damaging 1.00
IGL02636:Timp4 APN 6 115249824 splice site probably null
R0534:Timp4 UTSW 6 115249841 missense probably damaging 1.00
R0671:Timp4 UTSW 6 115249853 missense probably damaging 1.00
R1698:Timp4 UTSW 6 115250403 intron probably null
R5994:Timp4 UTSW 6 115247354 missense probably damaging 1.00
R7537:Timp4 UTSW 6 115250460 missense probably damaging 0.96
R7869:Timp4 UTSW 6 115250394 missense probably benign 0.09
Z1177:Timp4 UTSW 6 115251777 start codon destroyed probably null 0.89
Predicted Primers PCR Primer
(F):5'- CATTTCAGTCTGCCACATGTG -3'
(R):5'- TTAATGACTGGGACTCCTGGGG -3'

Sequencing Primer
(F):5'- CACATGTGGTTGCTGGTGTCC -3'
(R):5'- GCCCCTAAGCCATCCCTG -3'
Posted On2018-05-24