Incidental Mutation 'R6433:Pex5'
ID518639
Institutional Source Beutler Lab
Gene Symbol Pex5
Ensembl Gene ENSMUSG00000005069
Gene Nameperoxisomal biogenesis factor 5
SynonymsESTM1, peroxisome biogenesis factor 5, PTS1R, Pxr1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6433 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location124396816-124415067 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 124413613 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 91 (M91K)
Ref Sequence ENSEMBL: ENSMUSP00000108151 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035861] [ENSMUST00000080557] [ENSMUST00000112530] [ENSMUST00000112531] [ENSMUST00000112532]
Predicted Effect possibly damaging
Transcript: ENSMUST00000035861
AA Change: M91K

PolyPhen 2 Score 0.811 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000049132
Gene: ENSMUSG00000005069
AA Change: M91K

DomainStartEndE-ValueType
low complexity region 231 247 N/A INTRINSIC
TPR 371 404 2.66e0 SMART
low complexity region 443 454 N/A INTRINSIC
TPR 488 521 1.76e-5 SMART
TPR 522 555 1.49e-3 SMART
TPR 556 589 3.87e-2 SMART
low complexity region 622 633 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000080557
AA Change: M91K

PolyPhen 2 Score 0.811 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000079398
Gene: ENSMUSG00000005069
AA Change: M91K

DomainStartEndE-ValueType
TPR 334 367 2.66e0 SMART
low complexity region 406 417 N/A INTRINSIC
TPR 451 484 1.76e-5 SMART
TPR 485 518 1.49e-3 SMART
TPR 519 552 3.87e-2 SMART
low complexity region 585 596 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000112530
AA Change: M91K

PolyPhen 2 Score 0.698 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000108149
Gene: ENSMUSG00000005069
AA Change: M91K

DomainStartEndE-ValueType
low complexity region 224 240 N/A INTRINSIC
TPR 364 397 2.66e0 SMART
low complexity region 436 447 N/A INTRINSIC
TPR 481 514 1.76e-5 SMART
TPR 515 548 1.49e-3 SMART
TPR 549 582 3.87e-2 SMART
low complexity region 615 626 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000112531
AA Change: M91K

PolyPhen 2 Score 0.811 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000108150
Gene: ENSMUSG00000005069
AA Change: M91K

DomainStartEndE-ValueType
TPR 334 367 2.66e0 SMART
low complexity region 406 417 N/A INTRINSIC
TPR 451 484 1.76e-5 SMART
TPR 485 518 1.49e-3 SMART
TPR 519 552 3.87e-2 SMART
low complexity region 585 596 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000112532
AA Change: M91K

PolyPhen 2 Score 0.811 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000108151
Gene: ENSMUSG00000005069
AA Change: M91K

DomainStartEndE-ValueType
low complexity region 231 247 N/A INTRINSIC
TPR 371 404 2.66e0 SMART
low complexity region 443 454 N/A INTRINSIC
TPR 488 521 1.76e-5 SMART
TPR 522 555 1.49e-3 SMART
TPR 556 589 3.87e-2 SMART
low complexity region 622 633 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150899
Meta Mutation Damage Score 0.6838 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.6%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene binds to the C-terminal PTS1-type tripeptide peroxisomal targeting signal (SKL-type) and plays an essential role in peroxisomal protein import. Peroxins (PEXs) are proteins that are essential for the assembly of functional peroxisomes. The peroxisome biogenesis disorders (PBDs) are a group of genetically heterogeneous autosomal recessive, lethal diseases characterized by multiple defects in peroxisome function. The peroxisomal biogenesis disorders are a heterogeneous group with at least 14 complementation groups and with more than 1 phenotype being observed in cases falling into particular complementation groups. Although the clinical features of PBD patients vary, cells from all PBD patients exhibit a defect in the import of one or more classes of peroxisomal matrix proteins into the organelle. Defects in this gene are a cause of neonatal adrenoleukodystrophy (NALD), a cause of Zellweger syndrome (ZWS) as well as may be a cause of infantile Refsum disease (IRD). Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Oct 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit reduced size, muscle weakness, respiratory distress, and retarded development and defects of the kidney, liver, brain, and intestine associated with lack of peroxisomes, and die within 3-4 days of birth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afdn T A 17: 13,881,299 D1016E probably damaging Het
Aplnr A T 2: 85,136,673 Q14L probably benign Het
Aspm T C 1: 139,473,683 L1147S probably damaging Het
Atad2b A G 12: 4,952,642 T337A possibly damaging Het
Atrn A G 2: 131,023,027 E1358G probably damaging Het
Caml C A 13: 55,623,249 S53R possibly damaging Het
Cd180 T G 13: 102,705,633 S396A probably benign Het
Cdhr2 A G 13: 54,718,512 T344A probably damaging Het
Cyp4a31 A C 4: 115,570,269 D224A probably damaging Het
Dhx36 T C 3: 62,484,974 T544A probably damaging Het
Dnah14 A G 1: 181,651,657 K1528E probably damaging Het
Dnpep T A 1: 75,315,378 K199N probably benign Het
Dsc2 C T 18: 20,051,175 probably null Het
Efl1 T A 7: 82,674,568 D239E probably damaging Het
Elovl4 A G 9: 83,785,178 V42A possibly damaging Het
Exoc3 T C 13: 74,189,187 T432A possibly damaging Het
Fam98c A G 7: 29,156,128 probably null Het
Fbln2 G A 6: 91,233,272 G66D probably damaging Het
Fchsd1 G A 18: 37,964,084 T410I possibly damaging Het
Flcn T C 11: 59,801,082 D247G probably damaging Het
Galnt16 T C 12: 80,575,903 V127A probably benign Het
H2-Ob A T 17: 34,243,886 probably null Het
Has2 G A 15: 56,667,798 S507F possibly damaging Het
Ido2 T A 8: 24,533,923 M300L probably damaging Het
Itga10 T C 3: 96,658,041 probably null Het
Klra9 G T 6: 130,179,032 Y253* probably null Het
Mfsd2a A G 4: 122,950,457 V299A probably benign Het
Mybpc1 T C 10: 88,560,355 D210G probably damaging Het
Ndrg1 A T 15: 66,933,872 M128K probably damaging Het
Obscn T A 11: 59,051,558 T5091S probably benign Het
Olfr137 A G 17: 38,305,413 L16P probably damaging Het
Phlpp2 G T 8: 109,934,685 A810S probably benign Het
Pla2g7 G C 17: 43,599,126 A174P probably damaging Het
Plxna4 C T 6: 32,215,678 V783M probably damaging Het
Poll A T 19: 45,553,604 M421K probably benign Het
Ppfia2 C A 10: 106,913,698 S1148R possibly damaging Het
Prkg1 A G 19: 30,781,346 F280S probably benign Het
Rdh10 G A 1: 16,107,855 C117Y probably damaging Het
Rtl1 C A 12: 109,595,196 A70S unknown Het
Scgb2b3 A T 7: 31,359,067 L104I probably benign Het
Sh3tc1 T C 5: 35,706,597 R749G probably damaging Het
Skint4 A G 4: 112,146,510 K380R probably benign Het
Smtnl1 A C 2: 84,818,368 S181A probably benign Het
Spata31d1b T C 13: 59,717,185 S716P probably damaging Het
Spc25 A G 2: 69,206,102 probably benign Het
Stab2 C T 10: 86,901,567 probably null Het
Timm22 T C 11: 76,409,744 V114A possibly damaging Het
Timp4 A G 6: 115,247,220 C163R probably damaging Het
Toporsl T A 4: 52,611,548 N480K possibly damaging Het
Tpo T C 12: 30,084,754 E735G probably benign Het
Trpm3 A G 19: 22,901,305 D692G probably damaging Het
Ttn T C 2: 76,751,714 H22945R probably damaging Het
Vmn2r6 A T 3: 64,547,380 Y499* probably null Het
Vwa1 G A 4: 155,772,769 H191Y probably benign Het
Other mutations in Pex5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01980:Pex5 APN 6 124398380 missense probably damaging 1.00
IGL02027:Pex5 APN 6 124398888 missense probably benign 0.20
IGL02041:Pex5 APN 6 124405281 splice site probably benign
IGL02128:Pex5 APN 6 124398460 missense probably damaging 1.00
IGL02507:Pex5 APN 6 124413305 missense probably benign
IGL02539:Pex5 APN 6 124403224 missense probably benign 0.02
IGL03180:Pex5 APN 6 124413563 splice site probably benign
R0143:Pex5 UTSW 6 124398489 missense probably damaging 1.00
R0600:Pex5 UTSW 6 124404637 missense probably benign 0.10
R0904:Pex5 UTSW 6 124399937 splice site probably benign
R1970:Pex5 UTSW 6 124414405 missense probably damaging 1.00
R4628:Pex5 UTSW 6 124403120 missense possibly damaging 0.90
R4879:Pex5 UTSW 6 124398363 missense probably benign 0.02
R5068:Pex5 UTSW 6 124413596 missense probably benign 0.01
R5069:Pex5 UTSW 6 124413596 missense probably benign 0.01
R5339:Pex5 UTSW 6 124398004 missense probably benign 0.02
R6825:Pex5 UTSW 6 124414381 missense probably damaging 0.98
R6851:Pex5 UTSW 6 124403154 missense possibly damaging 0.92
R7148:Pex5 UTSW 6 124405272 missense probably benign 0.10
R7286:Pex5 UTSW 6 124398063 nonsense probably null
R7673:Pex5 UTSW 6 124399383 missense probably damaging 0.98
R7752:Pex5 UTSW 6 124403901 missense probably damaging 0.99
R7752:Pex5 UTSW 6 124414018 missense probably benign 0.03
R7793:Pex5 UTSW 6 124399341 missense probably benign 0.00
Z1177:Pex5 UTSW 6 124398386 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTCAGACAAGGCCAAATCTG -3'
(R):5'- TCTGTCCAACATCAGTGGGC -3'

Sequencing Primer
(F):5'- AATCTGCCACACCAGGGG -3'
(R):5'- AACATCAGTGGGCCCTGC -3'
Posted On2018-05-24