Incidental Mutation 'R6433:Efl1'
ID 518643
Institutional Source Beutler Lab
Gene Symbol Efl1
Ensembl Gene ENSMUSG00000038563
Gene Name elongation factor like GTPase 1
Synonyms D7Ertd791e, 6030468D11Rik, 4932434J20Rik, Eftud1
MMRRC Submission 044571-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.870) question?
Stock # R6433 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 82297822-82427060 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 82323776 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 239 (D239E)
Ref Sequence ENSEMBL: ENSMUSP00000137061 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039881] [ENSMUST00000141726] [ENSMUST00000179489]
AlphaFold Q8C0D5
Predicted Effect probably damaging
Transcript: ENSMUST00000039881
AA Change: D239E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000046046
Gene: ENSMUSG00000038563
AA Change: D239E

DomainStartEndE-ValueType
Pfam:GTP_EFTU 17 365 7.4e-62 PFAM
low complexity region 435 451 N/A INTRINSIC
Pfam:EFG_II 614 687 4.3e-9 PFAM
EFG_C 986 1075 1.03e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125245
Predicted Effect probably benign
Transcript: ENSMUST00000141726
SMART Domains Protein: ENSMUSP00000121909
Gene: ENSMUSG00000038563

DomainStartEndE-ValueType
Pfam:GTP_EFTU 17 222 2.3e-57 PFAM
Pfam:MMR_HSR1 21 147 2e-6 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153265
Predicted Effect probably damaging
Transcript: ENSMUST00000179489
AA Change: D239E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000137061
Gene: ENSMUSG00000038563
AA Change: D239E

DomainStartEndE-ValueType
Pfam:GTP_EFTU 17 364 8.7e-58 PFAM
low complexity region 435 451 N/A INTRINSIC
Pfam:GTP_EFTU_D2 504 599 1e-7 PFAM
Pfam:EFG_II 614 687 1.8e-9 PFAM
EFG_C 986 1075 1.03e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208798
Meta Mutation Damage Score 0.0942 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.6%
Validation Efficiency 100% (56/56)
MGI Phenotype PHENOTYPE: Mice homozygous for an ENU-induced mutation exhibit late-onset and progressive gait abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afdn T A 17: 14,101,561 (GRCm39) D1016E probably damaging Het
Aplnr A T 2: 84,967,017 (GRCm39) Q14L probably benign Het
Aspm T C 1: 139,401,421 (GRCm39) L1147S probably damaging Het
Atad2b A G 12: 5,002,642 (GRCm39) T337A possibly damaging Het
Atrn A G 2: 130,864,947 (GRCm39) E1358G probably damaging Het
Caml C A 13: 55,771,062 (GRCm39) S53R possibly damaging Het
Cd180 T G 13: 102,842,141 (GRCm39) S396A probably benign Het
Cdhr2 A G 13: 54,866,325 (GRCm39) T344A probably damaging Het
Cyp4a31 A C 4: 115,427,466 (GRCm39) D224A probably damaging Het
Dhx36 T C 3: 62,392,395 (GRCm39) T544A probably damaging Het
Dnah14 A G 1: 181,479,222 (GRCm39) K1528E probably damaging Het
Dnpep T A 1: 75,292,022 (GRCm39) K199N probably benign Het
Dsc2 C T 18: 20,184,232 (GRCm39) probably null Het
Elovl4 A G 9: 83,667,231 (GRCm39) V42A possibly damaging Het
Exoc3 T C 13: 74,337,306 (GRCm39) T432A possibly damaging Het
Fam98c A G 7: 28,855,553 (GRCm39) probably null Het
Fbln2 G A 6: 91,210,254 (GRCm39) G66D probably damaging Het
Fchsd1 G A 18: 38,097,137 (GRCm39) T410I possibly damaging Het
Flcn T C 11: 59,691,908 (GRCm39) D247G probably damaging Het
Galnt16 T C 12: 80,622,677 (GRCm39) V127A probably benign Het
H2-Ob A T 17: 34,462,860 (GRCm39) probably null Het
Has2 G A 15: 56,531,194 (GRCm39) S507F possibly damaging Het
Ido2 T A 8: 25,023,939 (GRCm39) M300L probably damaging Het
Itga10 T C 3: 96,565,357 (GRCm39) probably null Het
Klra9 G T 6: 130,155,995 (GRCm39) Y253* probably null Het
Mfsd2a A G 4: 122,844,250 (GRCm39) V299A probably benign Het
Mybpc1 T C 10: 88,396,217 (GRCm39) D210G probably damaging Het
Ndrg1 A T 15: 66,805,721 (GRCm39) M128K probably damaging Het
Obscn T A 11: 58,942,384 (GRCm39) T5091S probably benign Het
Or2j3 A G 17: 38,616,304 (GRCm39) L16P probably damaging Het
Pex5 A T 6: 124,390,572 (GRCm39) M91K possibly damaging Het
Phlpp2 G T 8: 110,661,317 (GRCm39) A810S probably benign Het
Pla2g7 G C 17: 43,910,017 (GRCm39) A174P probably damaging Het
Plxna4 C T 6: 32,192,613 (GRCm39) V783M probably damaging Het
Poll A T 19: 45,542,043 (GRCm39) M421K probably benign Het
Ppfia2 C A 10: 106,749,559 (GRCm39) S1148R possibly damaging Het
Prkg1 A G 19: 30,758,746 (GRCm39) F280S probably benign Het
Rdh10 G A 1: 16,178,079 (GRCm39) C117Y probably damaging Het
Rtl1 C A 12: 109,561,630 (GRCm39) A70S unknown Het
Scgb2b3 A T 7: 31,058,492 (GRCm39) L104I probably benign Het
Sh3tc1 T C 5: 35,863,941 (GRCm39) R749G probably damaging Het
Skint4 A G 4: 112,003,707 (GRCm39) K380R probably benign Het
Smtnl1 A C 2: 84,648,712 (GRCm39) S181A probably benign Het
Spata31d1b T C 13: 59,864,999 (GRCm39) S716P probably damaging Het
Spc25 A G 2: 69,036,446 (GRCm39) probably benign Het
Stab2 C T 10: 86,737,431 (GRCm39) probably null Het
Timm22 T C 11: 76,300,570 (GRCm39) V114A possibly damaging Het
Timp4 A G 6: 115,224,181 (GRCm39) C163R probably damaging Het
Toporsl T A 4: 52,611,548 (GRCm39) N480K possibly damaging Het
Tpo T C 12: 30,134,753 (GRCm39) E735G probably benign Het
Trpm3 A G 19: 22,878,669 (GRCm39) D692G probably damaging Het
Ttn T C 2: 76,582,058 (GRCm39) H22945R probably damaging Het
Vmn2r6 A T 3: 64,454,801 (GRCm39) Y499* probably null Het
Vwa1 G A 4: 155,857,226 (GRCm39) H191Y probably benign Het
Other mutations in Efl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00541:Efl1 APN 7 82,307,319 (GRCm39) missense probably damaging 1.00
IGL00696:Efl1 APN 7 82,301,080 (GRCm39) splice site probably benign
IGL01344:Efl1 APN 7 82,330,688 (GRCm39) splice site probably benign
IGL01871:Efl1 APN 7 82,412,527 (GRCm39) missense possibly damaging 0.64
IGL01941:Efl1 APN 7 82,347,184 (GRCm39) missense probably benign 0.17
IGL02104:Efl1 APN 7 82,307,263 (GRCm39) critical splice acceptor site probably null
IGL02150:Efl1 APN 7 82,335,899 (GRCm39) missense probably benign
IGL02484:Efl1 APN 7 82,332,247 (GRCm39) missense probably damaging 0.98
IGL03140:Efl1 APN 7 82,342,089 (GRCm39) missense probably benign 0.00
IGL03188:Efl1 APN 7 82,320,909 (GRCm39) missense probably damaging 1.00
IGL03014:Efl1 UTSW 7 82,301,094 (GRCm39) missense probably damaging 1.00
PIT4469001:Efl1 UTSW 7 82,307,373 (GRCm39) missense probably benign 0.14
R0148:Efl1 UTSW 7 82,320,878 (GRCm39) missense probably damaging 1.00
R0226:Efl1 UTSW 7 82,342,219 (GRCm39) splice site probably benign
R0638:Efl1 UTSW 7 82,301,095 (GRCm39) missense probably damaging 1.00
R0684:Efl1 UTSW 7 82,301,094 (GRCm39) missense probably damaging 1.00
R1018:Efl1 UTSW 7 82,412,221 (GRCm39) missense possibly damaging 0.94
R1290:Efl1 UTSW 7 82,320,936 (GRCm39) missense probably damaging 1.00
R1720:Efl1 UTSW 7 82,332,929 (GRCm39) missense possibly damaging 0.50
R1933:Efl1 UTSW 7 82,412,325 (GRCm39) nonsense probably null
R1973:Efl1 UTSW 7 82,412,085 (GRCm39) missense probably damaging 1.00
R2016:Efl1 UTSW 7 82,402,917 (GRCm39) missense probably damaging 1.00
R2124:Efl1 UTSW 7 82,342,121 (GRCm39) missense probably damaging 1.00
R2290:Efl1 UTSW 7 82,426,878 (GRCm39) missense probably damaging 1.00
R2415:Efl1 UTSW 7 82,347,175 (GRCm39) missense probably damaging 1.00
R3545:Efl1 UTSW 7 82,412,018 (GRCm39) missense probably benign 0.00
R3688:Efl1 UTSW 7 82,412,178 (GRCm39) missense probably benign 0.00
R4092:Efl1 UTSW 7 82,412,035 (GRCm39) missense probably benign 0.00
R4207:Efl1 UTSW 7 82,400,024 (GRCm39) missense probably damaging 0.98
R4347:Efl1 UTSW 7 82,347,174 (GRCm39) missense probably damaging 1.00
R4425:Efl1 UTSW 7 82,412,491 (GRCm39) missense probably damaging 0.99
R4816:Efl1 UTSW 7 82,320,927 (GRCm39) missense probably damaging 1.00
R4858:Efl1 UTSW 7 82,320,835 (GRCm39) missense probably damaging 1.00
R5077:Efl1 UTSW 7 82,307,295 (GRCm39) missense probably damaging 1.00
R5185:Efl1 UTSW 7 82,421,707 (GRCm39) missense probably damaging 1.00
R5319:Efl1 UTSW 7 82,323,714 (GRCm39) missense probably damaging 1.00
R5771:Efl1 UTSW 7 82,341,732 (GRCm39) missense probably benign 0.26
R5857:Efl1 UTSW 7 82,412,397 (GRCm39) missense probably benign
R5956:Efl1 UTSW 7 82,301,107 (GRCm39) missense probably damaging 1.00
R7131:Efl1 UTSW 7 82,307,272 (GRCm39) missense probably damaging 1.00
R7143:Efl1 UTSW 7 82,411,888 (GRCm39) missense probably damaging 1.00
R7312:Efl1 UTSW 7 82,330,652 (GRCm39) missense probably benign 0.10
R7409:Efl1 UTSW 7 82,347,121 (GRCm39) missense probably damaging 0.98
R7422:Efl1 UTSW 7 82,330,587 (GRCm39) missense probably damaging 1.00
R7453:Efl1 UTSW 7 82,330,675 (GRCm39) missense possibly damaging 0.76
R7504:Efl1 UTSW 7 82,332,257 (GRCm39) missense probably damaging 1.00
R7884:Efl1 UTSW 7 82,307,307 (GRCm39) missense probably damaging 1.00
R7969:Efl1 UTSW 7 82,342,178 (GRCm39) missense probably benign 0.03
R8394:Efl1 UTSW 7 82,411,986 (GRCm39) missense probably benign 0.00
R8702:Efl1 UTSW 7 82,399,998 (GRCm39) critical splice acceptor site probably null
R8924:Efl1 UTSW 7 82,412,161 (GRCm39) missense probably benign 0.03
R9463:Efl1 UTSW 7 82,426,733 (GRCm39) missense probably damaging 1.00
R9762:Efl1 UTSW 7 82,412,596 (GRCm39) missense probably benign 0.09
Z1088:Efl1 UTSW 7 82,342,058 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CCTAGATTAACGCACTTACAGGAAC -3'
(R):5'- GCTTCAGTCCCATCTCCAAG -3'

Sequencing Primer
(F):5'- ACGCACTTACAGGAACTCTTTTTAC -3'
(R):5'- CGAATGTCCTCTAGCATGACAGTG -3'
Posted On 2018-05-24