Incidental Mutation 'R6433:Ido2'
ID518644
Institutional Source Beutler Lab
Gene Symbol Ido2
Ensembl Gene ENSMUSG00000031549
Gene Nameindoleamine 2,3-dioxygenase 2
SynonymsIndol1, C230043N17Rik, Ido2
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6433 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location24531892-24576333 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 24533923 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 300 (M300L)
Ref Sequence ENSEMBL: ENSMUSP00000113979 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000121992]
Predicted Effect probably damaging
Transcript: ENSMUST00000121992
AA Change: M300L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113979
Gene: ENSMUSG00000031549
AA Change: M300L

DomainStartEndE-ValueType
Pfam:IDO 15 399 1.4e-124 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138335
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140417
Meta Mutation Damage Score 0.4747 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.6%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Along with the enzymes encoded by the INDO (MIM 147435) and TDO2 (MIM 191070) genes, the enzyme encoded by the INDOL1 gene metabolizes tryptophan in the kynurenine pathway (Ball et al., 2007 [PubMed 17499941]).[supplied by OMIM, Feb 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired T cell function and decreased susceptibility to type IV hypersensitivity reaction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afdn T A 17: 13,881,299 D1016E probably damaging Het
Aplnr A T 2: 85,136,673 Q14L probably benign Het
Aspm T C 1: 139,473,683 L1147S probably damaging Het
Atad2b A G 12: 4,952,642 T337A possibly damaging Het
Atrn A G 2: 131,023,027 E1358G probably damaging Het
Caml C A 13: 55,623,249 S53R possibly damaging Het
Cd180 T G 13: 102,705,633 S396A probably benign Het
Cdhr2 A G 13: 54,718,512 T344A probably damaging Het
Cyp4a31 A C 4: 115,570,269 D224A probably damaging Het
Dhx36 T C 3: 62,484,974 T544A probably damaging Het
Dnah14 A G 1: 181,651,657 K1528E probably damaging Het
Dnpep T A 1: 75,315,378 K199N probably benign Het
Dsc2 C T 18: 20,051,175 probably null Het
Efl1 T A 7: 82,674,568 D239E probably damaging Het
Elovl4 A G 9: 83,785,178 V42A possibly damaging Het
Exoc3 T C 13: 74,189,187 T432A possibly damaging Het
Fam98c A G 7: 29,156,128 probably null Het
Fbln2 G A 6: 91,233,272 G66D probably damaging Het
Fchsd1 G A 18: 37,964,084 T410I possibly damaging Het
Flcn T C 11: 59,801,082 D247G probably damaging Het
Galnt16 T C 12: 80,575,903 V127A probably benign Het
H2-Ob A T 17: 34,243,886 probably null Het
Has2 G A 15: 56,667,798 S507F possibly damaging Het
Itga10 T C 3: 96,658,041 probably null Het
Klra9 G T 6: 130,179,032 Y253* probably null Het
Mfsd2a A G 4: 122,950,457 V299A probably benign Het
Mybpc1 T C 10: 88,560,355 D210G probably damaging Het
Ndrg1 A T 15: 66,933,872 M128K probably damaging Het
Obscn T A 11: 59,051,558 T5091S probably benign Het
Olfr137 A G 17: 38,305,413 L16P probably damaging Het
Pex5 A T 6: 124,413,613 M91K possibly damaging Het
Phlpp2 G T 8: 109,934,685 A810S probably benign Het
Pla2g7 G C 17: 43,599,126 A174P probably damaging Het
Plxna4 C T 6: 32,215,678 V783M probably damaging Het
Poll A T 19: 45,553,604 M421K probably benign Het
Ppfia2 C A 10: 106,913,698 S1148R possibly damaging Het
Prkg1 A G 19: 30,781,346 F280S probably benign Het
Rdh10 G A 1: 16,107,855 C117Y probably damaging Het
Rtl1 C A 12: 109,595,196 A70S unknown Het
Scgb2b3 A T 7: 31,359,067 L104I probably benign Het
Sh3tc1 T C 5: 35,706,597 R749G probably damaging Het
Skint4 A G 4: 112,146,510 K380R probably benign Het
Smtnl1 A C 2: 84,818,368 S181A probably benign Het
Spata31d1b T C 13: 59,717,185 S716P probably damaging Het
Spc25 A G 2: 69,206,102 probably benign Het
Stab2 C T 10: 86,901,567 probably null Het
Timm22 T C 11: 76,409,744 V114A possibly damaging Het
Timp4 A G 6: 115,247,220 C163R probably damaging Het
Toporsl T A 4: 52,611,548 N480K possibly damaging Het
Tpo T C 12: 30,084,754 E735G probably benign Het
Trpm3 A G 19: 22,901,305 D692G probably damaging Het
Ttn T C 2: 76,751,714 H22945R probably damaging Het
Vmn2r6 A T 3: 64,547,380 Y499* probably null Het
Vwa1 G A 4: 155,772,769 H191Y probably benign Het
Other mutations in Ido2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0413:Ido2 UTSW 8 24558143 splice site probably null
R1103:Ido2 UTSW 8 24576223 missense probably benign 0.08
R1601:Ido2 UTSW 8 24576189 missense possibly damaging 0.57
R1868:Ido2 UTSW 8 24553760 missense possibly damaging 0.90
R2158:Ido2 UTSW 8 24540636 missense probably damaging 1.00
R2266:Ido2 UTSW 8 24535252 missense probably damaging 1.00
R2267:Ido2 UTSW 8 24535252 missense probably damaging 1.00
R2268:Ido2 UTSW 8 24535252 missense probably damaging 1.00
R2484:Ido2 UTSW 8 24533815 missense probably damaging 1.00
R3151:Ido2 UTSW 8 24533760 missense possibly damaging 0.61
R3735:Ido2 UTSW 8 24535193 missense probably damaging 0.98
R3820:Ido2 UTSW 8 24533755 missense probably benign 0.00
R3821:Ido2 UTSW 8 24533755 missense probably benign 0.00
R3822:Ido2 UTSW 8 24533755 missense probably benign 0.00
R4520:Ido2 UTSW 8 24576178 missense probably damaging 0.99
R4824:Ido2 UTSW 8 24533859 missense probably benign 0.12
R4949:Ido2 UTSW 8 24533954 critical splice acceptor site probably null
R5235:Ido2 UTSW 8 24547186 missense probably damaging 0.99
R5580:Ido2 UTSW 8 24550866 missense possibly damaging 0.67
R5961:Ido2 UTSW 8 24533770 missense probably damaging 1.00
R7085:Ido2 UTSW 8 24558196 missense probably benign 0.09
R7186:Ido2 UTSW 8 24550810 synonymous probably null
R7248:Ido2 UTSW 8 24540641 nonsense probably null
R7248:Ido2 UTSW 8 24548823 missense probably damaging 0.97
R7287:Ido2 UTSW 8 24535138 splice site probably null
R7788:Ido2 UTSW 8 24547226 missense probably damaging 0.99
R8026:Ido2 UTSW 8 24535140 critical splice donor site probably null
R8191:Ido2 UTSW 8 24533680 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTGAGGGATTAGTTAGCCC -3'
(R):5'- GTGTCTCCTGTCAACAACCAG -3'

Sequencing Primer
(F):5'- AGGGATTAGTTAGCCCCCTGC -3'
(R):5'- GTGTCTCCTGTCAACAACCAGAAATG -3'
Posted On2018-05-24